Search Strains

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.

dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.

dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.

dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.

dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.

twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

oaSi41 [par-5p::GFP::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

knu1099 is an engineered 7437 bp deletion in spin-4. Flanking sequences immediately outside of the region deleted ares: 5? flank (forward strand), 5?- GTT CGG TGG AGC GCG CCT GCG -3’; 3? flank (reverse strand), 5?- GTC TGT GTT GCT GTT CCT CAT -3’. In between these flanking sequences, a three-frame stop as well as a unique primer-binding sequence were inserted in place of the deleted sequence. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Flora Y & Bohnert KA. Dev Biol. 2023 Dec:504:137-148. doi: 10.1016/j.ydbio.2023.09.013. PMID: 37805103.

knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

nmDf1 removes all four tandem paralogs of the mss family (Cre-mss-1, Cre-mss-2, Cre-mss-3, and Cre-mss-4). Male sperm is less competitive than wild-type male sperm, and females have lower brood size due to inbreeding depression. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.

mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nm85 is a likely null frameshift mutation in the sperm-expressed Cbr-msrp-3, but has no apparent reproductive phenotypes. To confirm presence of nm85 mutation, use primers AT19+AT20 (WT: 291 nt, nm85: 286 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6. Removal of all six Cbr-msrp paralogs has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of nm86 mutation, use primers AT130+AT131 (WT: 184 nt, nm86: 224 nt). AT130: CGAAATAATTGAACCTACCAAGA. AT131: CACTCTCTCTGACTGCAAACG. To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

When singled, hermaphrodites should throw 2/3 hermaphrodites and 1/2 nm2 XX males. The lethal appears to balance the nm2 allele pretty well, but precise recombination mapping has not been performed. The XX males maintain their phenotypic resemblance to the unbalanced strain and are probably not fertile due to obvious gonadal deficiencies. This strain has been successfully grown at 15C and 20C. Both strains appear to have complete penetrance of the mutant phenotypes.

Small body size. Crumpled spicules. Male ray 8-9 fusion.

qcIs59 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Small Rollers. GFP::SMA-3 fusion protein is expressed in the intestine. Derivative of a strain described in Wang et al., 2002, Development 129:4989-4998.

Small body size. Crumpled spicules. Male ray 8-9 fusion.

zaIs5 [alg-1p::GFP::alg-1 + rol-6(su1006)]. Some GFP+ animals do not roll. GFP::ALG-1 expression throughout development, detectable as punctate cytoplasmic granules. Maintain by picking rollers. Reference: Chan SP, Slack FJ. Dev Biol. 2009 Oct 1;334(1):152-60.

Mild defect in cell corpse engulfment.

Mild defect in cell corpse engulfment.

Slow growth. Reference: Breckenridge DG, et al. Mol Cell. 2008 Aug 22;31(4):586-97.

Homozygous viable. Slow growth but not lethal or sterile. Reference: Breckenridge DG, et al. Mol Cell. 2008 Aug 22;31(4):586-97.

Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP fan-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smogorzewska A, et al. (2010) Molec Cell 39:36-47.

rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029

siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055.

Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Decreased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Derived by outcrossing RB785 three times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Derived by outcrossing VC260 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.