Search Strains

Mesorhabditis spiculigera. Isolated in Pennsylvania. NOTE: (06/10/2016) AF72 was originally described as Mesorhabditis miotki, but K. Kiontke has determined through morphological inspection that this is actually a strain of Mesorhabditis spiculigera.

Neodiplogasteridae: Pristionchus Iheritieri, Maupas, 1919. Isolated in Ontario, Canada. [9/98: Ralf Sommer has found this strain to be hermaphroditic. He had successful matings between AF8130 and PS312 Pristionchus pacificus, indicating that AF8130 is probably P. pacificus.]

adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. The transgene has been inserted on chromosome II, using the MosSCI technique. This strains expresses the SPD-1 protein fused to GFP in the germline (both males and females) and in embryos. SPD-1 is nucleolar in interphase and labels the central spindle in mitosis and meiosis, later accumulating at the midbody. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9. doi: 10.1091/mbc.E14-12-1577.

kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Temperature-sensitive maternal-effect lethal. Maintain at 15C. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and EU822. Unknown if unc-119(ed3) is still present or homozygous in background. NOTE: this strain was originally described as heterozygous for lin-2(e1309), but lin-2 has been lost; this strain is now homozygous wild-type for lin-2. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

Homozygotes produce 10-15% XO male self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. me8 disrupts the function of the cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment.

sDf19 has a dominant twitcher phenotype, and is homozygous lethal-usually arresting as embryos, but occasionally will hatch. Heterozygotes are twitchers and segregate twitchers, Vulvaless and dead eggs (or lethal early larvae). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Original isolation: BO strain BC1261 unc-22(s727) hermaphrodite heat shocked for 1 hour at 34C. Crossed to N2 strain BC1270 unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Picked individual WT hermaphrodites. Screened for the absence of gravid Unc-22. Retained strain as BC1379. Balanced over eT1: BC1379 unc-22(s727)[BO]/nT1[N2] IV; sDf31[BO]/nT1[N2] hermaphrodite crossed to BC 1265 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Pick WT hermaphrodites that twitch in 1% nicotine. Retained one strain that segregated Unc-36 as BC1428. Pseudolinked sDf31 to dpy-18: BC1428 +/eT1 III; sDf31[BO]/eT1 V crossed to BC 1265 dpy-18/eT1 III; unc-46/eT1 V male. Picked WT hermaphrodite F1. From strains segregating Unc-36 but no Dpy or Unc-46 or DpyUnc-46, cross WT hermaphrodites to BC1265 males. From strains producing Dpy, crossed individual WT males to BC70 eT1;eT1. From each cross, crossed WT X WT. Kept one strain producing on Dpy or DpyUncs as S-H716 male. Picked one hermaphrodite to start BC1519. Comments: 1) The LGV region balanced by eT1 should be all BO. 2) Probably the rest of the genome still has a considerable amount from BO since it was crossed to N2 only 4 times. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

srl-2 is a recessive suppressor of the s1040 temperature sensitive lethal phenotype. srl-2 has no effect on the Roller phenotype of s1040. (At 20C, s1040 homozygotes arrest development at mid-larval stage. At 15C, s1040 homozygotes are viable weak left-handed rollers.) Maintain at 20C to select for retention of suppressor. Animals at 20C will be DpyUncRol.

srl-1 is a recessive suppressor of the s1040 temperature sensitive lethal phenotype. srl-1 has no effect on the Roller phenotype of s1040. (At 20C, s1040 homozygotes arrest development at mid-larval stage. At 15C, s1040 homozygotes are viable weak left-handed rollers.) Maintain at 20C to select for retention of suppressor. Animals at 20C will be DpyUncRol.

Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

crgSi2081 [rpl-28p::PuroR + myo-2p::GFP + Cbr-unc-119(+)] II. Superficially wild-type. Puromycin resistant. ttTi5605 transposon in EG4322 has been replaced by a single copy insertion crgSi2081. Reference: Semple JI, et al., Nat Methods. 2010 Sep;7(9):725-7.

hmIs4 [des-2::GFP + rol-6(su1006)]. Dpy Rollers. eff-1(ok1021) was outcrossed 6 times. PVD neurons are hyperbranched and have disorganized menorah structures. Shows reduced sensitivity to strong mechanical stimuli. eff-1(ok1021) is a null allele and has strong arborization and cell fusion defects. Pick rollers to maintain. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8.

antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

zbIs2 [pie-1p::lifeact::RFP::pie-1 3' UTR + unc-119(+)]. Lifeact tag labels F-actin without interfering F-actin dynmics. The strain has never been officially published; however, a GFP version of this transgene is described in Pohl C & Bao Z. Dev Cell. 2010 Sep 14;19(3):402-12. PMID: 20833362.

Maintain at 15C. Temperature sensitive embryonic lethal. Sterile at 25C. Congenic strain, N2 and Bergerac BE. This allele should NOT be assumed to define a gene to which someone gave the name zyg-12. This name should not be used unless someone finds a non-complementing Bristol mutation. There is no evidence at present that the ts results from a single gene defect. Has been backcrossed >6 times to Bristol strains and should only contain Bergerac DNA in the unc-85 to dpy-10 region.

ieSi6 [htp-3p::htp-3::GFP + Cbr-unc-119(+)] II. Maintain at 20C. Although silencing of the transgene has not observed, it may be helpful to maintain it over htp-3(tm3655) to continually select for expression. unc-119(ed3) might not be homozygous in this strain. Reference: Kim et al. Dev Cell. 2015 Oct 26;35(2):247-61.

Homozygous viable and looks almost normal by dissecting scope, but under Nomarski microscopy the gut has a very abnormal spongy appearance, which is especially noticeable in L4 larvae.

Long. Mechanosensory Abnormal. [NOTE: originally described as carrying e1084, this strain actually carries the e75 allele. The lesion has been verified by sequence analysis. (11/26/2018)]

e1873 allele is the only anc-1 allele in which the molecular lesion has been identified (Starr and Han, 2002) and is considered by the authors to be the reference allele. e1873 does not revert, unlike most other alleles of anc-1. Reference: Hedgecock and Thomson. Cell. 1982 Aug;30(1):321-30. Starr and Han. Science. 2002 Oct 11;298(5592):406-9.

WT heterozygote, fem-1(e1965) maternal. Segregates WT heterozygotes, WT fem-1 homozygotes that give only fertile female progeny, and UncMor. (Probably has lost mor-2 [Edgley, 4/92]. When confirmed, should be given a new strain name.)

eIs2137 [sup-7(+) + Dm-hsp::lacZ] IV. lacZ expression induced by heat shock. Limited pattern (the pSHZ1 vector was originally designed for use in Drosophila, not C. elegans, and is not the best vector for expression of lacZ in the worm). This strain has predominantly historical value (as the first C. elegans strain shown to express a foreign gene). eIs2137 transgene is integrated and contains two plasmids: pAST (sup-7 amber suppressor), and pSHZ1 (lacZ driven by Drosophila heat shock promoter (S. Munro)).

From CB1490, which is a double mutant of him-5 with ali-1. CB4088 has been outcrossed to remove ali-1.

Spongy gut, intestine has foamy look, especially in L4; Temperature sensitive-almost normal at 15C; leaky Eat at 20C; Penetrant and sick Eat at 25C. Unc.

Male-female strain. Reference WBG 9(3) 121. Isolated from sugar cane in Trinidad by D.J. Hunt (Commonwealth Institute of Parasitology). [7/7/93: Scott Baird and David Fitch question whether this strain is really C. remanei.] [7/95: Not cross-fertile with the authentic C. remanei isolated by Walter Sudhaus.] Previously called C. remanei by the CGC. Walter Sudhaus has tentatively described this strain as Caenorhabditis sp.; this description is not offical and is contigent upon its being published. See WBPaper00002633 and WBPaper00003993. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.

Isolated in 1991 by Carlos E. Winter in soil samples taken at the University of Sao Paulo in Brazil. Hermaphrodite strain. Adults are smaller than C. elegans. The life cycle is a little longer than C. elegans at 22C. Each lays about 300 eggs in the three days following the moult from L4 to adult. Eggs are laid just after being fertilized resulting sometimes in plates with many eggs (much more than C. elegans). See Comp. Biochem. Physiol 103B: 189, 1992. See Nematology 2(1): 89-98, 2000. Can be grown and maintained on NGM. L1s easily frozen and stored in liquid nitrogen. This strain is deposited in Paul Sternberg's collection under the name PS1022. The species has not yet been determined; Lynn Carta will publish a paper proposing Oscheius brevesophaga. DO NOT use this name before the paper is published. Contact Carles E. Winter or Lynn Carta before publishing anything official about this strain. See also WBPaper00004471 and WBPaper00004485. AKA Oscheius sp. 1.

muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.

muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]

mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus

dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.

nmIs11 [Cbr-msrp-3(+) + Cbr-unc-119(+) + myo-2::GFP]. GFP expression in pharynx. Wild-type (non-Unc) movement. Roughly two-fold over-expression of Cbr-msrp-3(+); has no measurable effect on fertility. Cbr-MSRP-3 is a sperm surface glycoprotein with homologs in C. elegans and other species. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

nmIs12 [Cbr-msrp-3(+) + Cbr-unc-119(+) + myo-2::GFP]. GFP expression in pharynx. Wild-type (non-Unc) movement. Roughly two-fold over-expression of Cbr-msrp-3(+); has no measurable effect on fertility. Cbr-MSRP-3 is a sperm surface glycoprotein with homologs in C. elegans and other species. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nm85 is a likely null frameshift mutation in the sperm-expressed Cbr-msrp-3, but has no apparent reproductive phenotypes. To confirm presence of nm85 mutation, use primers AT19+AT20 (WT: 291 nt, nm85: 286 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6, but has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6. Removal of all six Cbr-msrp paralogs has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of nm86 mutation, use primers AT130+AT131 (WT: 184 nt, nm86: 224 nt). AT130: CGAAATAATTGAACCTACCAAGA. AT131: CACTCTCTCTGACTGCAAACG. To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

When singled, hermaphrodites should throw 2/3 hermaphrodites and 1/2 nm2 XX males. The lethal appears to balance the nm2 allele pretty well, but precise recombination mapping has not been performed. The XX males maintain their phenotypic resemblance to the unbalanced strain and are probably not fertile due to obvious gonadal deficiencies. This strain has been successfully grown at 15C and 20C. Both strains appear to have complete penetrance of the mutant phenotypes.

rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029

Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.

Note: ad702 was isolated in an RC301 background. DA702 was not tested for the presence of npr-1(g320) following three rounds of outcrossing to N2 Bristol. DA702 does not display clumping behavior, so it's likely that DA702 has the Bristol npr-1. New stock rec'd 10/13/99.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.

DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).