More Fields
Strain Species Genotype
ATU2301 C. elegans aceIs1; goeIs3. Show Description
goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator cytosolic GCaMP3 and mitochondrial LAR-GECO in all body wall muscles.
BW1927 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC161 C. elegans mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC162 C. elegans mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC163 C. elegans mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC164 C. elegans mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC165 C. elegans mir-784(umn72[mir-784p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC166 C. elegans mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC167 C. elegans mir-787(umn74[mir-787p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC168 C. elegans mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC169 C. elegans mir-788(umn76[mir-788p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-788 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
CGC170 C. elegans mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
CGC171 C. elegans mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC172 C. elegans mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC179 C. elegans mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
CGC180 C. elegans mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
HBR191 C. elegans goeIs5. Show Description
goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
HBR205 C. elegans goeIs22. Show Description
goeIs22 [mec-4p::SL1::GCaMP3.35::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several mechanosensitive neurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
HBR2256 C. elegans goeEx737. Show Description
goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted).
HBR4 C. elegans goeIs3. Show Description
goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. Reporter expresses the calcium indicator GCaMP3 in all body wall muscles. Reference: Schwarz J, et al. Worm. 2012 Jan 1;1(1):12-4.
SL1138 C. elegans spe-42(tn1231) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Heterozygotes are Unc and express myo-2::GFP in the pharynx. spe-42(tn1231) homozygotes are non-Unc and non-GFP. spe-42(tn1231) produces <1 self progeny at 16C and no self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.