BC4586 |
C. elegans |
unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. Show Description
Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%.
Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details.
doi.org/10.1038/s41598-021-97764-9
|
|
BS509 |
C. elegans |
ozDf2/dpy-21(e428) par-4(it33) V. Show Description
Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type.
|
|
CB2810 |
C. elegans |
tra-1(e1575)/+ III; unc-42(e270) him-5(e1490) dpy-21(e428) V. Show Description
Pick Unc hermaphrodite to maintain (these will be tra-1/+; unc-42 him-5 dpy-21 XO animals). Segregates Unc hermaphrodites (tra-1/+ III), Unc males (+/+ III), and DpyUnc hermaphrodites (+/+ III). dpy-21 not expressed in XO. dpy-21(e428) V; XX animals are weak Dpy. dpy-21(e428) V; XO animals are non-Dpy.
|
|
CB3252 |
C. elegans |
rnt-1(e1241) I; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and Him. Males are non-Dpy and Mab. Males have abnormal bursa and defective rays. Both sexes show lateral hypodermis lineage defexts. M-MATING+POOR <1%WT.
|
|
CB3298 |
C. elegans |
him-5(e1490) dpy-21(e428) V; mab-7(e1599) X. Show Description
Hermaphrodites are Dpy. Males are non-Dpy and have abnormal bursae in adult, with swollen rays. Males will mate, but with very low efficiency. [3/98: King Chow isolated a line from the CGC stock that was throwing 100% Mabs. Sent the strain back to the CGC to replace the old stock.]
|
|
CB3299 |
C. elegans |
mab-5(e1239) III; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and segregate males. Males are non-Dpy and Mab. Both sexes show lineage alterations.
|
|
CB3353 |
C. elegans |
mab-9(e1245) II; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and segregates males. Males are non-Dpy and have severe tail abnormalities; frequently lethal to adult males.
|
|
CB428 |
C. elegans |
dpy-21(e428) V. Show Description
Dpy hermaphrodites. Males (XO) non-Dpy. M-MATING++++ >30%WT.
|
|
CB4883 |
C. elegans |
let-551(e2517)/dpy-21(e428) rol-9(sc148) V. Show Description
Heterozygotes are WT and segregate WT, Lethals (L2/L3 arrest at 20C, some survive to sterile adults at 15C), and DpyRol. Not balanced well: get recombinants. Must maintain by picking hets at each generation and check for proper segregants in F1.
|
|
EV232 |
C. elegans |
gck-3(tm1296)/dpy-21(e428) V. Show Description
Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpy, and sterile tm1296 homozygotes. Dev Biol. 2010 Aug 15;344(2):758-71.
|
|
JR41 |
C. elegans |
unc-76(e911) wDf1/unc-61(e228) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.
|
|
MT9926 |
C. elegans |
efl-1(n3318)/unc-76(e911) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, UncDpy and Mel. Received new stock from the Horvitz lab 5/04.
|
|
RG3104 |
C. elegans |
cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3311 |
C. elegans |
fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3327 |
C. elegans |
T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
TY3936 |
C. elegans |
dpy-21(e428) V. Show Description
Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.
|
|
CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
CGC136 |
C. elegans |
mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
|
|
CGC137 |
C. elegans |
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
|
|
CGC153 |
C. elegans |
mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
UL4285 |
C. elegans |
unc-68(le4285) V. Show Description
The UNC-68a N2441S missense mutation (le4285) corresponds to a human myopathic variant, RyR1:p.N2342S. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
|
|