More Fields
Strain Species Genotype
CGC112 C. elegans mir-250(umn23[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus.
CGC111 C. elegans mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet.
CGC115 C. elegans mir-61&mir-250(umn26[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci.
CGC110 C. elegans mir-250(umn21[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC114 C. elegans mir-61&mir-250(umn25[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC113, leaving myo-2p::wrmScarlet.
CGC113 C. elegans mir-61&mir-250(umn24[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
JK5455 C. elegans q833 V/nT1[qIs51](IV; V). Show Description
hets are green pharynx WT and segregate green pharynx WT, fertile non-green pharynx and dead eggs (nT1 homozygotes). q833 is a 472 bp deletion into the intergenic region between mir-61/ mir-250 and F55A11.4.
MT14875 C. elegans nDf59 V. Show Description
mir-61 (F55A11.9), mir-250 (F55A11.12) and part of F55A11.3 are deleted in nDf59. Deletion breakpoints are:TGGATTTCCACAACAACCAGCTGGTGCC / GGAGGTGCTCAGCCTGG...GTTCTAGTCATTGCC / ATACGGAGGAAGGACTAAGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17676 C. elegans mir-45(n4280) II; nDf59 V; mir-247(n4505) X. Show Description
nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73.