More Fields
Strain Species Genotype
AC365 C. elegans sao-1(ok3335) V. Show Description
Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
BA585 C. elegans spe-10(hc104) unc-76(e911) V. Show Description
Unc. Temperature sensitive, maintain at 16C. Average progeny: at 16C= 7 +/- 5; at 25C= 0.1 +/- .1.
BC4586 C. elegans unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. Show Description
Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details.
BS518 C. elegans ozDf1/sdc-3(y52y180) unc-76(e911) V. Show Description
Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.
CB2065 C. elegans dpy-11(e224) unc-76(e911) V. Show Description
CU6102 C. elegans skr-1(sm151) I; unc-76(e911) V. Show Description
sm151 is a semi-dominant allele of skr-1. Maintain under normal conditions. Reference: Killian DJ, et al. (2008) Dev Biol. 322(2):322-31.
CU7905 C. elegans smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
CU9087 C. elegans unc-76(e911) V; smIs380. Show Description
smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
DA709 C. elegans +/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.
DA869 C. elegans sqt-3(sc8) lin-25(n545) him-5(e1467) unc-76(e911) V. Show Description
Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8).
DR188 C. elegans daf-11(m47) unc-76(e911) V. Show Description
Temperature sensitive dauer constitutive. Dauer recovery poor at 15C. Unc.
DR96 C. elegans unc-76(e911) V. Show Description
Coiler Unc. Recessive. Easily scored.
EL129 C. elegans ego-3(om40) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects.
HS1215 C. elegans unc-76(e911) V; osEx211. Show Description
osEx211[apr-1::GFP + unc-76(+)]. This strain expresses functional APR-1::GFP driven by the apr-1 promoter. In the seam cells, just prior to the onset of mitosis, APR-1::GFP localizes to the anterior cortex.
HS1257 C. elegans unc-76(e911) V; osEx219. Show Description
osEx219 [pbrm-1::GFP + unc-76(+)]. Pick wild-type to maintain. GFP expression in most somatic nuclei. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.
HS1294 C. elegans unc-76(e911) V; osEx225. Show Description
osEx225 [scm::dsh-2::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
HS1325 C. elegans unc-76(e911) V; osEx229. Show Description
osEx229 [pry-1::GFP + unc-76(+)]. This strain expresses functional pry-1::GFP driven by the pry-1 promoter. In the seam cells, just prior to the onset of mitosis, pry-1::GFP localizes to the anterior cortex.
HS1359 C. elegans unc-76(e911) V; osEx233. Show Description
osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
HS1380 C. elegans unc-76(e911) V; osEx240. Show Description
osEx240 [bet-1p::bet-1::GFP + unc-76(+)]. Pick Wild-type (non-Unc) to maintain. GFP expression in most somatic cells. Reference: Shibata Y, et al. Development. 2010 Apr;137(7):1045-53.
HS2329 C. elegans unc-76(e911) V; osEx397. Show Description
osEx397 [cwn-1p::cwn-1::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in tail region. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS2332 C. elegans unc-76(e911) V; osEx393. Show Description
osEx393 [cwn-2p::cwn-2::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in the pharynx. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS321 C. elegans him-5(e1467) unc-76(e911) V; osEx67. Show Description
osEx67 [psa-4::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.
HS325 C. elegans him-5(e1467) unc-76(e911) V; osEx71. Show Description
osEx71 [psa-1::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.
HS942 C. elegans unc-76(e911) V; osEx158. Show Description
osEx158 [wrm-1::GFP + unc-76(+)]. Animals with the array are WT and GFP+. Animals which have lost the array are Unc and GFP-.
IA123 C. elegans cdc-25.1(ij48) I; unc-76(e911) ijIs10 V. Show Description
ijIs10 [cpr-5::GFP::lacZ + unc-76(+)]. Extra intestinal cells.
JR113 C. elegans sma-1(e30) unc-76(e911) wDf2/sqt-3(sc8) unc-61(e228) V. Show Description
Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).
JR41 C. elegans unc-76(e911) wDf1/unc-61(e228) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.
ML743 C. elegans rdy-2(mc40)/sqt-3(sc63) him-5(e1467) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Rol Uncs, and dead L2 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
MT10408 C. elegans lin-53(n833) I; unc-76(e911) V; lin-15A(n767) X; nEx998. Show Description
nEx998 [lin-53::GFP + unc-76(+)]. Pick non-Unc, non-Muv to maintain.
MT10865 C. elegans unc-76(e911) V; nEx1039. Show Description
nEx1039 contains [ced-10p::GFP::ced-10 + unc-76(+)]. Maintain at 20 C. Described in Lunquist et al., Development 128, 4475-4488 (2001).
MT2663 C. elegans sqt-3(sc63) him-5(e1467) egl-1(n986) unc-76(e911) V. Show Description
Dominant Egl. Unc. Dpy (ts). Throws males.
MT3553 C. elegans egl-43(n997) II; unc-76(e911) V. Show Description
n997: Egl, 5HT-S, IMIP-R.
MT5439 C. elegans sqt-3(sc8) unc-76(e911) V; lon-2(e678) xol-1(y70) X. Show Description
Roller. Long. Unc. XO Lethal. sc8 previously called rol-4(sc8).
MT6940 C. elegans dpy-20(e1282) IV; unc-76(e911) V. Show Description
Unc. Temperature sensitive Dpy.
MT9926 C. elegans efl-1(n3318)/unc-76(e911) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, UncDpy and Mel. Received new stock from the Horvitz lab 5/04.
OC235 C. elegans sun-1(bs12) unc-76(e911) V. Show Description
Unc. bs12 mutation causes sublethal defect in attachment of centrosome to the nucleus in early embryos. Viable 15-25 C. Reference: Kemp et al. (2007) Genetics 176:95-113.
RG3411 C. elegans C34G6.3(ve911[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 480 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGAAGAAGAAGACTTCAAATTTGTCGGT ; Right flanking sequence: GGGCCACCCGCCAGGGCTGTTCAGCAACCG. C34G6.3 sgRNA A: TTCAAGATCCCAAACTTCTG; C34G6.3 sgRNA B: TTGAAGCAAGACATTACACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SP1493 C. elegans sma-1(e30) unc-76(e911)/vab-8(e1017) V. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and animals with a posterior half that is thin, pale, uncoordinated.
SS268 C. elegans dpy-11(e224) mes-4(bn23) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc (n754 is a dominant Unc and recessive lethal). Throws DpyUncs which give sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 2% maternal effect embryonic lethality.
TY1077 C. elegans C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY1388 C. elegans C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY832 C. elegans yDf4/dpy-11(e224) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
TY873 C. elegans yDf6/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc, and dead eggs. Maintain by picking WT.
TY903 C. elegans yDf7/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and dead eggs. Maintain by picking WT.
TY956 C. elegans sdc-3(y132)/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.
VT581 C. elegans dpy-5(e61) lin-28(n719) I; lin-46(ma164) unc-76(e911) V. Show Description
Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.
XW5399 C. elegans unc-76(e911) V; qxIs257. Show Description
qxIs257 [ced-1p::nuc-1::mCherry + unc-76(+)]. Integrated nuc-1::mCherry transgene marking lysosomes in epidermal cells. Site of chromosomal integration unknown. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
XW8056 C. elegans unc-76(e911) V; qxIs430. Show Description
qxIs430 [scav-3::GFP + unc-76(+)]. Integrated GFP translational fusion transgene marking lysosomes in epithelial cells. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
ZH1963 C. elegans enIs59 I; unc-76(e911) V. Show Description
enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187
ZH2486 C. elegans enIs74 II; unc-76(e911) V. Show Description
enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.