More Fields
Strain Species Genotype
BC125 C. elegans dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14.
OP81 C. elegans unc-119(ed3) III; wgIs81. Show Description
wgIs81 [eor-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
SYS81 C. elegans ujIs113 II; skn-1(hq82([skn-1::gfp]) IV. Show Description
GFP knockin at C-terminus of skn-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
YL445 C. elegans unc-119(ed3) III; vrIs81. Show Description
vrIs81 [pie-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
BC2507 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) cdc-25.2(s819) dpy-11(e224)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT.
BC2646 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-410(s815)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
BC2908 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-423(s818)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
GOU2936 C. elegans spc-1(cas815[spc-1::GFP]) X. Show Description
Endogenous spc-1 locus tagged with GFP at C-terminus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GS8190 C. elegans arTi85. Show Description
arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
NM2739 C. elegans aex-3(js815) X. Show Description
Aex and aldicarb resistant.
NM2775 C. elegans elks-1(js816) IV. Show Description
Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.
OP810 C. elegans unc-119 (tm4063) III; wgIs810. Show Description
wgIs810 [C06A6.2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.
PS8114 C. elegans dod-18(sy1190) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-18; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTGAAACAGCTAAAGGAAAATTGACGACTA Right flanking sequence: TTGTGGAAGAAATGAAAAGAAAAGAGgtatagtta inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGGAAAATTGACGACTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8116 C. elegans C17H12.4(sy1192) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C17H12.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAAAATTAAGATTTCAAAAACCAGAACCGCCT Right flanking sequence: GAGAAATGGACCGGAGTGAGAAATGCAAAAGgtatg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCGGTCCATTTCTCAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8118 C. elegans srx-51(sy1194) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-51; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAACTCATTTGGAATGCTGACTACATCACAGTCTA Right flanking sequence: TTGGGGATGCAGTTATTTCAACAATTTTTGCATTT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GACTACATCACAGTCTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8120 C. elegans gnrr-4(sy1196) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGACTGCATCGTTCTCTTTATCTACGCTCCAACT Right flanking sequence: CAGTTTGCATGGATTCACTCATACTGGgtaagtctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAATCCATGCAAACTGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8175 C. elegans Y55B1BR.1(sy1201) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8179 C. elegans pals-14(sy1205) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTAAATCCAGTTTAGCAGAGAGAAAAGCGGCAGAG Right flanking sequence: GAGAGGCACAACAAAGCGgtatgatcatgcttacc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAGAAAAGCGGCAGAGGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8181 C. elegans pals-16(sy1207) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8185 C. elegans H39E23.3(sy1210) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of H39E23.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGGTCACTGTTCAAGGATTCCCTACAAAAGATC Right flanking sequence: GTGAGGCCAGAGAGACTGAACCAGTGAAACTGCCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTCCCTACAAAAGATCGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8189 C. elegans nlp-76(sy1214) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8191 C. elegans nlp-77(sy1216) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616