CZ2611 |
C. elegans |
vab-2(ju1) efn-2(ev658) IV; efn-3(ev696) X. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.
|
|
CZ4111 |
C. elegans |
vab-2(ju1) IV. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.
|
|
IC700 |
C. elegans |
juIs73 II; vab-2(ju1) IV. Show Description
juIs73 [unc-25p::GFP] II.
|
|
ABR156 |
C. briggsae |
Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
|
|
CZ1758 |
C. elegans |
juIs76 II; max-1(ju142) V. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.
|
|
CZ1931 |
C. elegans |
juIs76 II; unc-71(ju156) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
|
|
CZ1935 |
C. elegans |
juIs76 II; unc-71(ju160) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
|
|
CZ19982 |
C. elegans |
mcu-1(ju1154) IV. Show Description
Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.
|
|
CZ22190 |
C. elegans |
rpm-1(ok364) rpms-1(ju1285) V. Show Description
ju1285 is a deletion in F07B7.12/rpms-1. Reference: Sun Y, et al. MicroPubl Biol. 2024 Dec 5;2024:10.17912/micropub.biology.001396. doi: 10.17912/micropub.biology.001396. PMID: 39712931.
|
|
CZ22714 |
C. elegans |
miro-3(ju1310) juSi271 I; miro-1(ju1306) IV; miro-2(ju1309) X. Show Description
juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.
|
|
CZ2485 |
C. elegans |
ahr-1(ju145) I. Show Description
|
|
CZ24990 |
C. elegans |
unc-44(ju1412[unc-44::GFP]) IV. Show Description
Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
|
|
CZ25013 |
C. elegans |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
|
|
CZ25415 |
C. elegans |
nmat-2(ju1514) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP nmat-2(ju1514) homozygotes (sterile adults). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
|
|
CZ25643 |
C. elegans |
nmat-1(ju1565) X. Show Description
Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
|
|
CZ25708 |
C. elegans |
prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT:
[GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer:
GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
|
|
CZ25941 |
C. elegans |
dlk-1(ju1579[gfp::dlk-1]) I. Show Description
Endogenous dlk-1 locus tagged with GFP using CRISPR/Cas9. GFP is not visible under compound fluorescence microscope. Reference: Sun Y, et al. Proc Natl Acad Sci U S A. 2023 Sep 26;120(39):e2302801120. doi: 10.1073/pnas.2302801120. PMID: 37722038.
|
|
CZ26389 |
C. elegans |
esyt-2(ju1408) III. Show Description
CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and
crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.
|
|
CZ26606 |
C. elegans |
vwa-8(ju1659) X. Show Description
Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263
|
|
CZ26660 |
C elegans |
micu-1(ju1155) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
|
|
CZ27508 |
C elegans |
micu-1(ju1783[micu-1::gfp]) IV. Show Description
GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
|
|
CZ27593 |
C. elegans |
bli-1(ju1789[bli-1::mNG::3xFLAG]) II. Show Description
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
CZ27748 |
C. elegans |
vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. Show Description
Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
|
|
CZ29092 |
C. elegans |
jsIs973 III; efa-6(*ju1658[GFP::efa-6] ju1903) IV. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for the mechanosensory neurons. ju1903 deletion removes N-terminus of EFA-6 and disrupts all known isoforms. No visible GFP::EFA-6 due to ju1903 deletion. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.
|
|
CZ29114 |
C. elegans |
bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
CZ29326 |
C. elegans |
col-12::mNG(ju1932) V. Show Description
mNG inserted at C-terminus of endogenous col-12 locus.
|
|
CZ3011 |
C. elegans |
unc-16(ju146) III. Show Description
Uncoordinated and egg-laying defective. T to C transition resulting in L75P.
|
|
CZ31328 |
C. elegans |
efa-6(ju1658[GFP::efa-6]) IV. Show Description
Endogenous efa-6 locus tagged with GFP using CRISPR/Cas9. GFP is visible under compound fluorescence microscope. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.
|
|
DP485 |
C. tropicalis |
Ctr-dpy-10(ed73) II. Show Description
Homozygotes for this mutation express a dumpy phenotype, while heterozygotes are roller and slightly shorter-than-wildtype in length. This Ctr-dpy-10 mutation will serve as a suitable syntenic marker for chromosome II mutations in C. tropicalis that does not impact the viability or fecundity of the organism. Generated in a C. tropicalis JU1373 background. Hermaphrodite. Culture at 20°C or above.
|
|
DR104 |
C. elegans |
dpy-18(e364) unc-25(e156) dnj-17(ju1162) III. Show Description
DpyUnc.
|
|
JU1018 |
C. briggsae |
mfIs42. Show Description
mfIs42 [Cel-sid-2 + Cel-myo-2::DsRed]. JU977 integrated with gamma-rays.
|
|
JU1038 |
C. briggsae |
Show Description
Isolated from rotting pears sampled below their tree on 15 Oct 2006 in Le Blanc (Indre, France). Sample plated on 16 Oct 2006. Picked as an adult on 18 Oct 2006. PrA1.
|
|
JU1082 |
C. remanei |
Show Description
Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 11, 2007, in small vegetable gardens in Okazaki (East of Nagoya), Aichi Prefecture, Japan. Isofemale line. Maintain by mating.
|
|
JU1084 |
C. remanei |
Show Description
Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 14, 2007, in small vegetable gardens next to the Kacho-en aviary (ca. 100 m) in Kakegawa, Shizuoka prefecture, Japan. Isofemale line. Maintain by mating.
|
|
JU1085 |
C. briggsae |
Show Description
Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 14, 2007, in the woods behind the parking lot of the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan (ca. 100 m from the aviary and 200 m from the vegetable gardens).
|
|
JU1086 |
C. remanei |
Show Description
Male-female strain. Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 14, 2007, in the woods behind the parking lot of the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan (ca. 100 m from the aviary and 200 m from the vegetable gardens). Isofemale line. Maintain by mating.
|
|
JU1087 |
C. remanei |
Show Description
Male-female strain. Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 18, 2007, in the Botanical Gardens of the University of Tokyo in Tokyo, Japan. Isofemale line. Maintain by mating.
|
|
JU1088 |
C. elegans |
Show Description
Isolated by Marie-Anne Felix from soil sampled on March 14, 2007, in the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan.
|
|
JU1171 |
C. elegans |
Show Description
Caenorhabditis elegans wild isolate. Isolated from a compost sample collected in April 2007 in Concepcion, Chile, in the Palomares area, 2 km NE of the town.
|
|
JU1172 |
C. elegans |
Show Description
Isolated from a sample of soil (compost) in a pot with rotting tomatoes collected in April 2007 in Concepcion, Chile, in the Villuco area, 3 km SE of the town.
|
|
JU1184 |
C. remanei |
mfEx34. Show Description
Male-female strain. mfEx34 [Cel-sid-2 + Cel-myo-2::DsRed]. Made by injection of PB4641 with a PCR product of the Cel-sid-2 gene and a myo-2::DsRed plasmid. Sensitive to RNAi by feeding.
|
|
JU1199 |
C. afra |
Show Description
Caenorhabditis sp. 7 Male-female strain. Isolated by Marie-Anne Felix from rotting citrus fruit sampled by M. Herrmann in Begoro, Ghana in June 2007. New male-female species of the elegans group. Does not produce cross-progeny with any of the other previous elegans group species. Isofemale line. Maintain by mating.
|
|
JU1200 |
C. elegans |
Show Description
Isolated by Tony Page from a compost heap sample recovered on 1 Aug 2007 in SouthWest Scotland 4°36.0' West 55°34.6' North.
|
|
JU1201 |
C. sinica |
Show Description
Caenorhabditis sinica wild isolate. Caenorhabditis sp. 5 Male-female strain. Isolated from a small fruit found in the Garden of Harmony in Suzhou, China, on August 17, 2007.
|
|
JU1202 |
C. sinica |
Show Description
Caenorhabditis sinica wild isolate. Caenorhabditis sp. 5 Male-female strain. Isolated from a small fruit found in the Feilaifeng Park in Hangzhou, China, on August 25, 2007. Similar fruit as JU1201.
|
|
JU1212 |
C. elegans |
Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
|
|
JU1213 |
C. elegans |
Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
|
|
JU1242 |
C. elegans |
Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
|
|
JU1246 |
C. elegans |
Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
|
|
JU1286 |
C. afra |
Show Description
Caenorhabditis sp. 7 Male-female strain. Caenorhabditis sp. 7 is currently an undescribed species. The sequenced strain, JU1286, is an isogenic inbred line derived from strain JU1199 by 20 consecutive matings of 1 virgin female and 1 male. The inbreeding was done by Marie-Anne Felix. Strain JU1199 was isolated in June 2007 by Matthias Herrmann from a rotting citrus fruit in Begoro, Ghana, Africa. C. sp. 7 is a gonochoristic species with about equal proportions of males and females.
|
|