More Fields
Strain Species Genotype
CZ2611 C. elegans vab-2(ju1) efn-2(ev658) IV; efn-3(ev696) X. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.
CZ4111 C. elegans vab-2(ju1) IV. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.
IC700 C. elegans juIs73 II; vab-2(ju1) IV. Show Description
juIs73 [unc-25p::GFP] II.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
CZ1758 C. elegans juIs76 II; max-1(ju142) V. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.
CZ1931 C. elegans juIs76 II; unc-71(ju156) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
CZ1935 C. elegans juIs76 II; unc-71(ju160) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
CZ19982 C. elegans mcu-1(ju1154) IV. Show Description
Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.
CZ22714 C. elegans miro-3(ju1310) juSi271 I; miro-1(ju1306) IV; miro-2(ju1309) X. Show Description
juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.
CZ2485 C. elegans ahr-1(ju145) I. Show Description
CZ24990 C. elegans unc-44(ju1412[unc-44::GFP]) IV. Show Description
Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25013 C. elegans unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
CZ26389 C. elegans esyt-2(ju1408) III. Show Description
CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.
CZ26606 C. elegans vwa-8(ju1659) X. Show Description
Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263
CZ26660 C elegans micu-1(ju1155) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
CZ27508 C elegans micu-1(ju1783[micu-1::gfp]) IV. Show Description
GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
CZ27748 C. elegans vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. Show Description
Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
CZ3011 C. elegans unc-16(ju146) III. Show Description
Uncoordinated and egg-laying defective. T to C transition resulting in L75P.
DR104 C. elegans dpy-18(e364) unc-25(e156) dnj-17(ju1162) III. Show Description
DpyUnc.
JU1018 C. briggsae mfIs42. Show Description
mfIs42 [Cel-sid-2 + Cel-myo-2::DsRed]. JU977 integrated with gamma-rays.
JU1038 C. briggsae Show Description
Isolated from rotting pears sampled below their tree on 15 Oct 2006 in Le Blanc (Indre, France). Sample plated on 16 Oct 2006. Picked as an adult on 18 Oct 2006. PrA1.
JU1082 C. remanei Show Description
Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 11, 2007, in small vegetable gardens in Okazaki (East of Nagoya), Aichi Prefecture, Japan. Isofemale line. Maintain by mating.
JU1084 C. remanei Show Description
Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 14, 2007, in small vegetable gardens next to the Kacho-en aviary (ca. 100 m) in Kakegawa, Shizuoka prefecture, Japan. Isofemale line. Maintain by mating.
JU1085 C. briggsae Show Description
Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 14, 2007, in the woods behind the parking lot of the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan (ca. 100 m from the aviary and 200 m from the vegetable gardens).
JU1086 C. remanei Show Description
Male-female strain. Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 14, 2007, in the woods behind the parking lot of the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan (ca. 100 m from the aviary and 200 m from the vegetable gardens). Isofemale line. Maintain by mating.
JU1087 C. remanei Show Description
Male-female strain. Isolated by Marie-Anne Felix from leaf litter/bark/soil sampled on March 18, 2007, in the Botanical Gardens of the University of Tokyo in Tokyo, Japan. Isofemale line. Maintain by mating.
JU1088 C. elegans Show Description
Isolated by Marie-Anne Felix from soil sampled on March 14, 2007, in the Kacho-en aviary in Kakegawa, Shizuoka prefecture, Japan.
JU1171 C. elegans Show Description
Caenorhabditis elegans wild isolate. Isolated from a compost sample collected in April 2007 in Concepcion, Chile, in the Palomares area, 2 km NE of the town.
JU1172 C. elegans Show Description
Isolated from a sample of soil (compost) in a pot with rotting tomatoes collected in April 2007 in Concepcion, Chile, in the Villuco area, 3 km SE of the town.
JU1184 C. remanei mfEx34. Show Description
Male-female strain. mfEx34 [Cel-sid-2 + Cel-myo-2::DsRed]. Made by injection of PB4641 with a PCR product of the Cel-sid-2 gene and a myo-2::DsRed plasmid. Sensitive to RNAi by feeding.
JU1199 C. afra Show Description
Caenorhabditis sp. 7 Male-female strain. Isolated by Marie-Anne Felix from rotting citrus fruit sampled by M. Herrmann in Begoro, Ghana in June 2007. New male-female species of the elegans group. Does not produce cross-progeny with any of the other previous elegans group species. Isofemale line. Maintain by mating.
JU1200 C. elegans Show Description
Isolated by Tony Page from a compost heap sample recovered on 1 Aug 2007 in SouthWest Scotland 4°36.0' West 55°34.6' North.
JU1201 C. sinica Show Description
Caenorhabditis sinica wild isolate. Caenorhabditis sp. 5 Male-female strain. Isolated from a small fruit found in the Garden of Harmony in Suzhou, China, on August 17, 2007.
JU1202 C. sinica Show Description
Caenorhabditis sinica wild isolate. Caenorhabditis sp. 5 Male-female strain. Isolated from a small fruit found in the Feilaifeng Park in Hangzhou, China, on August 25, 2007. Similar fruit as JU1201.
JU1212 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
JU1213 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
JU1242 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
JU1246 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
JU1286 C. afra Show Description
Caenorhabditis sp. 7 Male-female strain. Caenorhabditis sp. 7 is currently an undescribed species. The sequenced strain, JU1286, is an isogenic inbred line derived from strain JU1199 by 20 consecutive matings of 1 virgin female and 1 male. The inbreeding was done by Marie-Anne Felix. Strain JU1199 was isolated in June 2007 by Matthias Herrmann from a rotting citrus fruit in Begoro, Ghana, Africa. C. sp. 7 is a gonochoristic species with about equal proportions of males and females.
JU1325 C. nigoni Show Description
Caenorhabditis sp. 9 Male-female strain. Isolated from rotting flowers and leaves sampled in the Zoo/Botanical Garden of Trivandrum, Kerala, India on 21 Dec 2007. Culture at 20°C or above. Reference: Félix, Braendle & Cutter, 2014
JU1333 C. doughertyi Show Description
Caenorhabditis sp. 10 Male-female strain. Isolated by Marie-Anne Félix from rotting cacao fruit sampled in Angela Spice Garden a few kilometers from Periyar, Kerala, India on 27 Dec 2007. Culture at 20°C or above.
JU1341 C. briggsae Show Description
Hermaphrodite. Isolated by MAF from rotting small red fruits (same as JU1342) and bark in the forest near the top of the mountain in Ponmudi, Kerala, India on 22 Dec 2007 (ca. 20 m from JU1340).
JU1345 C. briggsae Show Description
Hermaphrodite. Isolated by MAF from dark brown "fruits" (1x1.5 cm) on fallen tree trunk in the forest near the top of the mountain in Ponmudi, Kerala, India on 22 Dec 2007.
JU1348 C. briggsae Show Description
Hermaphrodite. Isolated by MAF from a mix of rotting fruits, leaf litter, soil, bark, flowers, etc. sampled in a ca. 3 km wide area in Periyar Natural Preserve, Kerala, India on 28 Dec 2007. Isolated from a plate containing a rotting fruit similar to that of sample #46 - JU1361/2).
JU1373 C. tropicalis Show Description
Caenorhabditis sp. 11 Isolated by Marie-Anne Felix from rotting torch ginger (Etlingeria elatior) flowers sampled in the island of La Réunion by Valérie Robert and Loïc Sablé in Jan 2008. Hermaphrodite. Culture at 20°C or above.
JU1395 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
JU1400 C. elegans Show Description
Isolated from rotting orange fruits, Garden Catalina de Ribera, Sevilla, Spain sampled on 29 Mar 08 by MAF. Not bleached.
JU1401 C. elegans Show Description
Isolated from Rumina decollata snail #4, sampled in front of the Parador of Carmona, Spain on 31 Mar 08 by MAF. Plated 3 Apr 08. Isolated as adult on 9 Apr 08.
JU1409 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.