More Fields
Strain Species Genotype
BC4586 C. elegans unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. Show Description
Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9
RG3104 C. elegans cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3311 C. elegans fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3327 C. elegans T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+  arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3355 C. elegans rpl-38(ve855[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous sterile. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+  sterile (ve855 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. May grow better at 15C. Left flanking Sequence: CTCTCGAAAGCAGAATTAAATTCGTTTAGA; Right flanking sequence: GCTCAAGTAGATCAAATCTCTTCTCTGCTC. rpl-38 sgRNA #1: ATCCACCATTGCGATGCCAA; rpl-38 sgRNA #2: TCCTTGACTTGGATGCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.