Spongy gut, intestine has foamy look, especially in L4; Temperature sensitive-almost normal at 15C; leaky Eat at 20C; Penetrant and sick Eat at 25C. Unc.

Unc. Eat.

Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Unc.

Unc-very slow and sluggish. Insensitive to prodding. Egl. Constitutive pharyngeal pumping. Long lived.

Linkage mapping strain. Maintain at 15C.

Patchy birefringence in pharyngeal muscles-semidominant.

Dpy (ts). Unc.

Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.

Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.

Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTACGAACTCTTCGTAATCAATTTCCCC ; Right flanking sequence: CGGTTTGCTTACCATATCTCTGGCGAGTCG. cal-1 sgRNA A: AAGTTGATGTGGATGGAGAC; cal-1 sgRNA B: TTCATGCTCCATGTTAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.