More Fields
Strain Species Genotype
CB3273 C. elegans lon-2(e678) mec-2(e75) X. Show Description
Long. Mechanosensory Abnormal. [NOTE: originally described as carrying e1084, this strain actually carries the e75 allele. The lesion has been verified by sequence analysis. (11/26/2018)]
CB75 C. elegans mec-2(e75) X. Show Description
Lethargic. Neurons touch abnormal. Mechanosensory abnormal-touch insensitive. Recessive. Phenotype severe. M-MATING+++ 10-30%WT.
UE75 C. elegans oaSi20 II; unc-119(ed3) III. Show Description
oaSi20 [par-5p::GFP::par-5::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
CB754 C. elegans rol-3(e754) V. Show Description
Left hand Roller. Incomplete penetrance. M-MATING+POOR <1%WT.
DA443 C. elegans rol-3(e754) unc-42(e270) V. Show Description
Roller Unc. e754 is cold-sensitive: lethal at 15C.
HBR191 C. elegans goeIs5. Show Description
goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
HBR205 C. elegans goeIs22. Show Description
goeIs22 [mec-4p::SL1::GCaMP3.35::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several mechanosensitive neurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
RG3252 C. elegans F10D2.10(ve752[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1587 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGTCCCTTCCGCATCAAAAATCTTTTT ; Right flanking sequence: gccgaatgaacagaccacttttttagaatg. sgRNA #1: CACAACCTCTGCCACCAAAT; sgRNA #2: cattctatcgtttactctcA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3253 C. elegans T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1497 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcacgtaaaattttcaaaatggttgacca ; Right flanking sequence: AGGATAAtaaaaaatcgtattttaaatgct. sgRNA #1: tatgtacacctgccccaaaa; sgRNA #2: ACGTGCCAATCAGTAGTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.