ZZ21 lev-1(x21) tra-3(e2333) isolated by Jim Lewis as EMS-induced levamisole resistant derivative of N2. Found to carry a cryptic tra-3 allele by Jonathan Hodgkin. XX animals are viable hermaphrodites which produce 500 rather than 330 self-progeny; occasionally Egl; no other signs of masculinization.

eEx24 [tra-3(+) + rol-6(su1006)]. Pick Rollers to maintain. Roller hermaphrodites producing more Rol hermaphrodites and non-Rol hermaphrodites that produce broods of 100% Tra-3 XX pseudomales. Tra-3 mutant rescued by transgenic tra-3(+); useful source of homozygous m+z- tra-3 XX hermaphrodites. Reference: Barnes & Hodgkin (1996) PMID: 8887539.

LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

eIs2137 [sup-7(+) + Dm-hsp::lacZ] IV. lacZ expression induced by heat shock. Limited pattern (the pSHZ1 vector was originally designed for use in Drosophila, not C. elegans, and is not the best vector for expression of lacZ in the worm). This strain has predominantly historical value (as the first C. elegans strain shown to express a foreign gene). eIs2137 transgene is integrated and contains two plasmids: pAST (sup-7 amber suppressor), and pSHZ1 (lacZ driven by Drosophila heat shock promoter (S. Munro)).

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Strain PD55 is transformed with plasmid pPD9.10 (which has a non-nuclear unc-54::lacZ fusion and a copy of the sup-7(st5) gene).

ccIs56 [sup-7(st5) +unc-54::lacZ] V. Non-nuclear unc-54::lacZ fusion expressed in nuclei and cytoplasm of body wall muscles.

tra-3 suppressed. Viable hermaphrodite. See also CGC 397.

Maternal effect tra-3. Heterozygotes are WT and segregate WT and Dpy. Homozygous tra-3 animals are WT hermaphrodites which segregate abnormal sterile males or intersex.

WT phenotype. tra-3 amber mutant carrying homozygous linked amber suppressor.

Stable male/female strain propagated by crossing tra-3(e1767)IV females x tra-3(e1767)IV males. tra-1(e1575) is semi-dominant and transforms both XX and XO into fertile females. Strain contains 4 genotypes: 1) e1575/+; e1767 XX which are fertile females. 2) e1575/+; e1767 XO which are fertile females. 3) e1767 XX which are infertile pseudomales. 4) e1767 XO which are fertile males.

Self-fertile intersexual XX animals. Tra-3 masculinized phenotype suppressed by egl-26 mutation. Reference: Hodgkin (1986) PMID: 3770465.

Wild type hermaphrodite phenotype, since tra-3(e1107) is fully suppressed.

Him. Temperature-sensitive: infertile above 20C. Variably masculinized XX hermaphrodites segregating normal XO males. Stronger XX masculinization than null alleles of tra-3. Reference: Francis et al. (1995) PMID: 7713420.

Levamisole resistant. Unc. tra-3 mutation discovered late. See Hodgkin & Barnes 1991 for genotype details.

Heterozygotes are WT and segregate WT, Dpy, Vul, and dead eggs. The Dpys throw Dpy males. Maintain by picking WT.

Hets are Unc and segregate Unc, WT hermaphrodites and dead eggs. The WT hermaphrodites segregate only abnormal sterile males or intersexes. Maintain by picking Unc.

Male/hermaphrodite strain, propagate by crossing. Fertile XX hermaphrodites and fertile XX males. Obligate XX strain with sex determined by amber-suppressing tRNA, sup-34. Reference: Strain 14 in Hodgkin (2002) PMID: 12399387.

Heterozygotes are Unc (shaker; don't move well) and segregate more Shaker Unc, WT and DpyUnc (short and fairly paralyzed). The WT give only males. e1957 previously called sup-21.

Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).

Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).