More Fields
Strain Species Genotype
CB4419 C. elegans tra-3(e2333) IV. Show Description
ZZ21 lev-1(x21) tra-3(e2333) isolated by Jim Lewis as EMS-induced levamisole resistant derivative of N2. Found to carry a cryptic tra-3 allele by Jonathan Hodgkin. XX animals are viable hermaphrodites which produce 500 rather than 330 self-progeny; occasionally Egl; no other signs of masculinization.
CB4834 C. elegans tra-3(e1108); eEx24. Show Description
eEx24 [tra-3(+) + rol-6(su1006)]. Pick Rollers to maintain. Roller hermaphrodites producing more Rol hermaphrodites and non-Rol hermaphrodites that produce broods of 100% Tra-3 XX pseudomales. Tra-3 mutant rescued by transgenic tra-3(+); useful source of homozygous m+z- tra-3 XX hermaphrodites. Reference: Barnes & Hodgkin (1996) PMID: 8887539.
RB1728 C. elegans tra-3(ok2207) IV. Show Description
LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CB4027 C. elegans tra-3(e1107) eIs2137 IV. Show Description
eIs2137 [sup-7(+) + Dm-hsp::lacZ] IV. lacZ expression induced by heat shock. Limited pattern (the pSHZ1 vector was originally designed for use in Drosophila, not C. elegans, and is not the best vector for expression of lacZ in the worm). This strain has predominantly historical value (as the first C. elegans strain shown to express a foreign gene). eIs2137 transgene is integrated and contains two plasmids: pAST (sup-7 amber suppressor), and pSHZ1 (lacZ driven by Drosophila heat shock promoter (S. Munro)).
PD55 C. elegans tra-3(e1107) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Strain PD55 is transformed with plasmid pPD9.10 (which has a non-nuclear unc-54::lacZ fusion and a copy of the sup-7(st5) gene).
PD56 C. elegans tra-3(e1107) IV; ccIs56 V. Show Description
ccIs56 [sup-7(st5) +unc-54::lacZ] V. Non-nuclear unc-54::lacZ fusion expressed in nuclei and cytoplasm of body wall muscles.
CB2318 C. elegans sup-5(e1464) III; tra-3(e1107) IV. Show Description
tra-3 suppressed. Viable hermaphrodite. See also CGC 397.
CB2612 C. elegans tra-3(e1107)/dpy-4(e1166) IV. Show Description
Maternal effect tra-3. Heterozygotes are WT and segregate WT and Dpy. Homozygous tra-3 animals are WT hermaphrodites which segregate abnormal sterile males or intersex.
CB3737 C. elegans sup-29(e1986) tra-3(e1903) IV. Show Description
WT phenotype. tra-3 amber mutant carrying homozygous linked amber suppressor.
CB3769 C. elegans tra-1(e1575)/+ III; tra-3(e1767) IV. Show Description
Stable male/female strain propagated by crossing tra-3(e1767)IV females x tra-3(e1767)IV males. tra-1(e1575) is semi-dominant and transforms both XX and XO into fertile females. Strain contains 4 genotypes: 1) e1575/+; e1767 XX which are fertile females. 2) e1575/+; e1767 XO which are fertile females. 3) e1767 XX which are infertile pseudomales. 4) e1767 XO which are fertile males.
CB4053 C. elegans egl-26(e1952) II; tra-3(e1767) IV. Show Description
Self-fertile intersexual XX animals. Tra-3 masculinized phenotype suppressed by egl-26 mutation. Reference: Hodgkin (1986) PMID: 3770465.
CB4425 C. elegans tra-3(e1107) sup-24(st354) IV. Show Description
Wild type hermaphrodite phenotype, since tra-3(e1107) is fully suppressed.
CB5365 C. elegans tra-3(bn75) IV; him-5(e1490) V. Show Description
Him. Temperature-sensitive: infertile above 20C. Variably masculinized XX hermaphrodites segregating normal XO males. Stronger XX masculinization than null alleles of tra-3. Reference: Francis et al. (1995) PMID: 7713420.
ZZ21 C. elegans lev-1(x21) tra-3(e2333) IV. Show Description
Levamisole resistant. Unc. tra-3 mutation discovered late. See Hodgkin & Barnes 1991 for genotype details.
CB3616 C. elegans tra-3(e1107) dpy-4(e1166)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy, Vul, and dead eggs. The Dpys throw Dpy males. Maintain by picking WT.
CB3988 C. elegans tra-3(e1107) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc and segregate Unc, WT hermaphrodites and dead eggs. The WT hermaphrodites segregate only abnormal sterile males or intersexes. Maintain by picking Unc.
CB5638 C. elegans sup-34(e2227)/+ I; tra-3(e1107) IV; xol-1(y9) X. [XX hermaphrodites and tra-3; xol-1 XX males] Show Description
Male/hermaphrodite strain, propagate by crossing. Fertile XX hermaphrodites and fertile XX males. Obligate XX strain with sex determined by amber-suppressing tRNA, sup-34. Reference: Strain 14 in Hodgkin (2002) PMID: 12399387.
CB3816 C. elegans tra-3(e1107) IV; unc-58(e665) sup-21(e1957) dpy-6(e14)/+ X. Show Description
Heterozygotes are Unc (shaker; don't move well) and segregate more Shaker Unc, WT and DpyUnc (short and fairly paralyzed). The WT give only males. e1957 previously called sup-21.
TY1807 C. elegans xol-1(y9) X. Show Description
Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).
TY525 C. elegans him-8(e1489) IV; xol-1(y9) X. Show Description
Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).