Search Strains

Homozygotes for this mutation express a dumpy phenotype, while heterozygotes are roller and slightly shorter-than-wildtype in length. This Ctr-dpy-10 mutation will serve as a suitable syntenic marker for chromosome II mutations in C. tropicalis that does not impact the viability or fecundity of the organism. Generated in a C. tropicalis JU1373 background. Hermaphrodite. Culture at 20°C or above.

Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.

Homozygotes lack gross phenotypes. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between miR-42* and miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.

Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.

Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between mir-42* and mir-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm3) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.

bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.

cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.

cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.

cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.

bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi86 [LoxN::rps-27p::DHB::GFP::P2A::H2B::mKate2] I. bmdSi86 is a single-copy CRISPR/Cas9-engineered insertion of a codon-optimized CDK sensor (amino acids 994–1087 of human DNA Helicase B (DHB) fused to GFP) co-expressed with his-58 (H2B) fused to two copies of mKate2. Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888

bmdSi147 [loxN::rps-27p::DHB::2xmKate2::P2A::H2B::GFP] I. bmdSi147 is a single-copy CRISPR/Cas9-engineered insertion of a codon-optimized CDK sensor (amino acids 994–1087 of human DNA Helicase B (DHB) fused to two copies of mKate2) co-expressed with his-58 (H2B) fused to GFP. Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888

bmdSi141 [loxN::eft-3p::his-58::GFP] I. Slow growing. Maintain at 15-20C. bmdSi141 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069

bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

Previously called C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years and carrues a 33-kilobase deletion that disrupts one of the srg paralogs, CBG24690, and six other genes. It is Unc, dauer-defective and ts lethal. Reference: McGrath PT, et al. Nature. 2011 Aug 17;477(7364):321-5.

WT phenotype. Segregates WT, homozygous Dpy-10 mIn1 and homozygous Unc-4 hermaphrodites. Recombination in this interval is suppressed, and recombinant animals have not been detected in this stock. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. mIn1 pka mC6.

WT phenotype. Segregates WT and DpyUncs. mDp4 carries dpy-13(+) and unc-24(+). Duplication may recombine with normal homologues. Presence of unc-17(e245) on mDp4 confirmed: got Unc-17 segregants after heat shock of this stock to generate males. Pick WT and check for segregation of progeny to maintain.

WT phenotype. Segregates WT, constitutive dauers and ts mild Uncs. Uncs are maternal-effect lethal: F1 Uncs from a heterozygote produce only arrested 2-fold stage progeny that hatch. Grow at 22.5C (n696 produces nearly 100% dauers at this temperature).

WT phenotype. Segregates WT, sterile Dpy mT1 homozygotes, Unc-4;Dpy-17 and large numbers of arrested aneuploid embryos. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]

Dark-bodied, unmarked variant of mIn19mC6) with small broods. Presumably balances let-552 to rol-1 (hermaphrodite stock obtained from outcrossing these males to dpy-10 unc-4 was shown to balance this interval). Isolated from DR1982 as a stock that no longer segregated Dpy-10 animals. Not clear whether this strain is the result of chromosome rearrangement in DR1982, or if DR1982 stock was a mixture of mIn1(+)/mIn[dpy-10] and mIn1(+) homozygotes.

WT gross phenotype, with GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Segregates WT, brighter Dpy GFP mIn1 homozygotes and non-GFP bli-2 unc-4 homozygotes. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. Pick WT, check for GFP and check for correct segregation of progeny to maintain. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence.

Heterozygotes are WT and segregate WT, Vul and dead eggs. Homozygous Df is embryonic lethal. Strain is sensitive to alpha-amanitin. New stock received from Patrice Albert 12/95. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy and dead eggs (mDf7/mDf7, nT1/nT1 and aneuploids). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 11/99 from Riddle lab.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 12/99 from Riddle lab.

Heterozygotes are semi-Dpy and segregate semi-Dpy, early larval lethals and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Animals which carry the Dup are semi-Dpy and segregate semi-Dpy and DpyUnc (animals which have lost the Dup). Animals homozygous for the Dup are slow growing, slender and transparent. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, early larval lethals and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes segregate wild-type GFP+ heterozygotes, GFP+ Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Pick GFP+ wild-type to maintain. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.

Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.

T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.

oxTi374 [unc-18(+) + ttTi5605 NeoR] V. oxEx1873 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi374 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in repressive region at position 3,339,184 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi176 [unc-18(+) + ttTi5605 NeoR] V. oxEx1807 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi176 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a generally permissive region at position 15,383,969 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).