More Fields
Strain Species Genotype
DM5117 C. elegans unc-52(gk3) II. Show Description
ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
AGK369 C. elegans zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AY143 C. elegans flp-21(ok889) V; flp-18(gk3063) X. Show Description
Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4.
CB7468 C. elegans acs-22(gk373989) X. Show Description
No obvious phenotype; derived from VC20689. Reference: O'Rourke et al (in preparation).
FT183 C. elegans cdc-42(gk388) II; unc-119(ed3) III; xnIs78. Show Description
xnIs78 [cdc-42p::2xHA::cdc-42 + unc-119(+)]. Superficially wild-type. Reference: Anderson DC, et al. (2008) Science 320(5884):1771-4.
GS7638 C. elegans exc-6(gk386) cyk-1(or596) III; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.
GS7960 C. elegans exc-6(gk386) cyk-1(or596) III; inft-2(ok1296) V; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.
OH158 C. elegans zig-4(gk34) X. Show Description
C09C7.1 Deletion breakpoints at position 237 and 803 with insertion of CTTGTATAGCAAGAAACC at this breakpoint. Predicted molecular null. About 30% penetrance of displaced axons in the ventral nerve cord. Homozygous viable.
QQ255 C. elegans gsy-1(gk397885) II. Show Description
Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates increased embryonic lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.
RG5004 C. elegans eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk3804 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC3837 and CGC48. gk3804 is a 717 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RM3156 C. elegans oct-1(gk354) I; cho-1(tm373) IV. Show Description
Slightly Lon and Unc. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM3248 C. elegans oct-1(gk354) I; cho-1(tm373) IV; chtl-1(ok1695) X. Show Description
Approximately wild-type in appearance, growth, and movement. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
TP91 C. elegans pdi-2(gk375)/lon-2(e678) X. Show Description
Maintain at 15 degrees. Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile.
UT1343 C. elegans crh-2(gk3293) II; crh-1(tz2) III. Show Description
Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
VC108 C. elegans H32C10(gk36) IV. Show Description
H32C10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC109 C. elegans apc-11(gk37)/eT1 III; +/eT1 V. Show Description
F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC110 C. elegans pus-1(gk38) V. Show Description
W06H3.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC111 C. elegans R13H4.2(gk39) V. Show Description
R13H4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1698 C. elegans nhr-118(gk3041) V. Show Description
This strain is homozygous for a deletion (gk3041) in F13A2.8, detectable by PCR using the following primers. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1081 bp. Deletion left flank: AGCCAGGTTTGCTCAAGGTAAAAAATGCCT. Deletion right flank: TTTTACTCCTTTTTCTACAGTCGTTGTTAT. Validation: gk3041 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1737 C. elegans F43C11.2(gk3131) II; F13A2.3(gk3132) V; W07E11.1(gk3133) F41G4(gk840) X. Show Description
This strain is homozygous for a deletion (gk840) in F41G4.1, detectable by PCR using the following primers. External left primer: TCGTTCTTTCGTAAAACCCG. External right primer: TTCTGGCTTAAGCTGCCAAT. Internal left primer: GAAGGCAAATTGCTCAGCTC. Internal right primer: TTCAATGTGATCGTCTTCGC. Internal WT amplicon: 1889 bp. Deletion size: 925 bp. Deletion left flank: TGCAGTGTAGAGTCGGGTCAAAAAGACAAG. Deletion right flank: AAGATCAACTACACCAGTCCAATTTTCAAT. Insertion Sequence: ATCAACAAA. Validation: No CGH probes for gk840. Other deletions (gk3131, gk3132, gk3133) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1749 C. elegans ZK185.2(gk828) F55G11.8(gk3130) IV. Show Description
This strain is homozygous for a deletion (gk828) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 1014 bp. Deletion left flank: TTAAAGAATAAATATTTCATTTGGAAGCTC. Deletion right flank: AGGGGCGCGTTAAGAAATCTTGGGTCTTTA. Validation: No CGH probes for gk828. Other deletion (gk3130) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1762 C. elegans nhr-113(gk852) I; F44E7.7(gk3134) V. Show Description
This strain is homozygous for a deletion (gk852) in ZK1025.9, detectable by PCR using the following primers. External left primer: ACATTGGCAAAACGACACAA. External right primer: CTTAGGTAGGCTGAGGTGCG. Internal left primer: TCCTGTCAAATTGCCTACCA. Internal right primer: CTGTCCCATTACGGCTTGAT. Internal WT amplicon: 2090 bp. Deletion size: 1150 bp. Deletion left flank: TTAAAAAAATAGAAAAAAAATAGTCAACTA. Deletion right flank: GAAAAGCCTGGAGGTCTACCGTGAACTAGG. Validation: gk852 passed by CGH. Other deletion (gk3134) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1767 C. elegans T24H10.1(gk3023) ldh-1(gk3142) II; gkDf25 V. Show Description
This strain is homozygous for a deletion (gk3023) in T24H10.1, detectable by PCR using the following primers. External left primer: GCACAGAAGGGTAGCTGGAG. External right primer: TTGGCTTCTGGCGTCTACTT. Internal left primer: ATGCGATAAATGGAGATGGC. Internal right primer: ACACGCGGTTATTAAGGTCG. Internal WT amplicon: 2047 bp. Deletion size: 568 bp. Deletion left flank: ATTAATACTCTCCGTCATTCTTTACCTTTT. Deletion right flank: AAATCTGCACAACTTCTACTTTCGGCACTT. Insertion Sequence: CATCTGCACA. Validation: gk3023 passed by CGH. Other deletions (gk3142, gkDf25) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1784 C. elegans str-148(gk3036) II; T28F3.1(gk1230) IV. Show Description
T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1793 C. elegans cTe154X.1(gk3143) III; ZK185.2(gk804) IV. Show Description
This strain is homozygous for a deletion (gk804) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 780 bp. Deletion left flank: ACTTGAATTTTTCCAGTAATTTTAGTTTTG. Deletion right flank: CTCTACCGGAGTTTGAAGGCACTTATTCGT. Validation: No CGH probes for gk804. Other deletion (gk3143) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1808 C. elegans grl-25(gk822) III; daf-3(gk3129) X. Show Description
This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1865 C. elegans ZK265(gk3042) I. Show Description
This strain is homozygous for a deletion (gk3042) in ZK265, detectable by PCR using the following primers. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 1123 bp. Deletion left flank: AAGAAGAACTGTGTGATGGGAAGCAGCAAA. Deletion right flank: AGACACTTGTGGATTCCTCGAGAAAAAGTG. Validation: No CGH probes for gk3042. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1892 C. elegans gkDf27 I; Y67A10A.7(gk3171) IV. Show Description
ZC581.1, ZC581.9, ZC581.12, C17F3.1, Y67A10A.7. Lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1923 C. elegans unc-22(gk3071) IV. Show Description
unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC1936 C. elegans madf-9(gk3057) IV. Show Description
madf-9. Homozygous viable deletion, detectable by nested PCR. External left primer: AACAAAACGCATAACCTCCG. External right primer: TCGGCCAAACTTCATTTTTC. Internal left primer: AAAGAGAGAAGAGGGAGCCG. Internal right primer: GGCCAAATCTTTGTGGTTTG. Internal WT amplicon: 1269 bp. Deletion size: 784 bp. Deletion left flank: CCTCCCAACCGCACACATACTACCAACGAT. Deletion right flank: TTAAATTGAGAAATGAAAAAAAAGGTCACG. Validation: gk3057 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1957 C. elegans sfxn-1.2(gk3039) II; flp-14(gk1055) III. Show Description
Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1971 C. elegans flp-24(gk3109) III. Show Description
This strain is homozygous for a deletion (gk3109) in C24A1.1, detectable by PCR using the following primers. External left primer: AGACCACGCCTACTACTTGGC. External right primer: CCATGTTGCTTCCAGTGCCAC. Internal left primer: CGATGTTCCGCTCTGAGCTTC. Internal right primer: TGGTCACAGTGCATTGCTCTC. Internal WT amplicon: 2029 bp. Deletion size: 1180 bp. Deletion left flank: TTTCGAAAGCTTGCCGCAAAACTCTGCCAT. Deletion right flank: AGACCTAAAAATTCCGGCAAATACCACATT. Validation: gk3109 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1979 C. elegans R12B2.3(gk3268) R12B2.2(gk3269) tbx-34(gk1051) III. Show Description
This strain is homozygous for a deletion (gk1051) in Y47D3A.10, detectable by PCR using the following primers. External left primer: AGTTGTGGCTTCTGCGAACT. External right primer: CACCCACTGACACCATTGAG. Internal left primer: ATGGTCAGGACGGGAATGTA. Internal right primer: TTTCTCCACTGCAACGTGAC. Internal WT amplicon: 2318 bp. Deletion size: 971 bp. Deletion left flank: TTTTTGTGCAGCAATTTTTGCGGCGGCTGA. Deletion right flank: GGTGTCAGTGAATGTAGGCAGCCATGAAGC. Validation: gk1051 passed by diagnostic PCR, CGH. Other deletions (gk3268, gk3269) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1985 C. elegans F47G4.6(gk1056) I; daf-3(gk3330) X. Show Description
This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2012 C. elegans flp-27(gk3331) Y17G7B.22(gk1062) II; gkDf45 X. Show Description
This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2016 C. elegans flp-18(gk3063) X. Show Description
Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2036 C. elegans unc-53(gk3156) II; gkDf26 V; hlh-19(gk1069) X. Show Description
T04H1.1, F45E10.1, F57C12.3, T04H1.3, T04H1.2. The gk1069 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AAGGAACCTGCGGGATAACT. External right primer: CTTCCAGTAGGCAGTCAGGC. Internal left primer: CTGCTCCTCTTCCACGAGAC. Internal right primer: CCTTGTGTCCGAGTCCTCAT. Internal WT amplicon: 2234 bp. Deletion size: 716 bp. Deletion left flank: AATTGGTTTTTTTGATAAAGTTTGATTAGT. Deletion right flank: TTTCCAATATTTCATCAATTATTTGAACGC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2071 C. elegans F39B2.1(gk3174) I. Show Description
This strain is homozygous for a deletion (gk3174) in F39B2.1, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: approximately 450 bp. Validation: gk3174 passed by CGH. Left deleted probe: CATGGTCGCGACGAGGCTCAATCTGATCCATCACGCCAACTTTTGTTTAA. Right deleted probe: GATAGAATTCAACAGAATTTTTCGAGTGAGTAAGGATTTCTGGACAGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2109 C. elegans Y53F4B.4&Y53F4B.42(gk1068) II; T25B9.10(gk3262) IV; K04C1.5(gk3263) X. Show Description
This strain is homozygous for a deletion (gk1068) in Y53F4B.4 and Y53F4B.42, detectable by PCR using the following primers. External left primer: GGCAAAATTGTACGCATCCT. External right primer: CTTGTTTCGCTCGATTCACA. Internal left primer: TCTCGTTAGGTATTTGCGGC. Internal right primer: CGCAACTGCGTTAAATCGTA. Internal WT amplicon: 2605 bp. Deletion size: 557 bp. Deletion left flank: AATAGAAAATGCATTTTAAAATGCGAAAAA. Deletion right flank: CCCGATTTTTGACCGATGACACCAAAGTTT. Validation: gk1068 passed by CGH. Other deletions (gk3262, gk3263) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2133 C. elegans C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2144 C. elegans T24F1.2(gk3219) II; T26A8.4(gk3176) IV; ubc-17(gk3220) X. Show Description
This strain is homozygous for a deletion (gk3176) in T26A8.4, detectable by PCR using the following primers. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: approximately 625 bp. Validation: gk3176 passed by CGH. Left deleted probe: TTGCGGTGGCTGAACTAATCCAGGCTGCTGAAGATGTGGATGTTGAATTG. Right deleted probe: AAACTAACCTTTTTACAAAAACTATTAGCATAAAAGTTGCACAGAACAGG. Other deletions (gk3219, gk3220) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2181 C. elegans C54E4.2(gk1083) IV; alh-2(gk3053) V. Show Description
K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC220 C. elegans cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. Show Description
This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2319 C. elegans ZK185.1(gk3229) IV. Show Description
ZK185.1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCAAGTCAGCGCCTCTTAT. External right primer: AATTCAGCGAAAATGATCCG. Internal left primer: TTGGCGATGAACGTACCATA. Internal right primer: AATCGTGTAGCTGGTGGAGG. Internal WT amplicon: 1766 bp. Deletion size: 472 bp. Deletion left flank: TTCACAAAAAGTTAGATAAAAAGGTTGTGC. Deletion right flank: CAGCTAGTTTTTGTGCATTTTCTCAGATGT. Insertion sequence at break: GGCTAGTTTTTGTG. Validation: gk3229 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2328 C. elegans gkDf19 gkDf20 II; F55C5.6(gk3058) rskd-1(gk1208) V. Show Description
T13B5.5, T13B5.6, T13B5.7, Y53F4B.25, Y53F4B.27, F55C5.6, F55C5.7. The allele gk1208 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AACTTCGGGAATGTCAATGC. External right primer: CAATTTTGGACCAACCCAAT. Internal left primer: GCCAGAGACCTTCCACAGAG. Internal right primer: ACTTTCAATTTCCGGACGTG. Internal WT amplicon: 2542 bp. Deletion size: 1329 bp. Deletion left flank: TCCCGGTTCTACGAATTCCAGAAGTAATAT. Deletion right flank: CTTCAGCTCTTTGAGCCGTTGCCACTAGCT. The allele gkDf19 was identified by CGH but not confirmed by PCR. Left flanking probe: AATGTGGAAAAGGGCTACTCGCTTGTCTATGCTGAAACGTAGGTTGTGAA. Right flanking probe: CACTTCATCTCAAGATTTCGTTGAGAAGTGTCGGTTGTATTGCCCCATGT. Left deleted probe: GATCTGGCAAAATGTTGTTGAAAACTTAAATTTTTCCACCAAGTTTTTGT. Right deleted probe: AATTGGGGATCCTTCTCCATGTGCCACAATATCAACCTGATTATTCGTAA. The allele gkDf20 was identified by CGH but not confirmed by PCR. Left flanking probe: ATGCTGTGAACGTGCTGGAATTCTATCGTTCCAAGGCGGAAAATGTATTC. Right flanking probe: GAAACTATGCGATTCGAGTGGAGAATAAGAAAAAGTCATCGTTGATTTCT. Left deleted probe: ATGTATTCCATTCTGTCGAACCCACGTGGCAACTCCTTCAAATGTTTTCG. Right deleted probe: TGGGAAAAGCCGGCCACCGCCATCTGGAAACTATGCGATTCGAGTGGAGA. The allele gk3058 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAAACCACTCTGGAAGACGATTTCATGGTTTTCGAGCCCAGTTCATGG. Right flanking probe: AATTCACTGTTTACCACTCTGTGAACCTGGATGTGTCAAGGGGTGCGACC. Left deleted probe: TGTTTATATTCCTGGAAACAGCATATAACCTTCTCTGTAGATTCAACGAT. Right deleted probe: AGTGTACAAGTGGCAGGTCACAACAGTATACTCTACGTACCAACTTCCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2329 C. elegans frm-1(gk1084) I; cTe154X.1(gk3193) III; gkDf29 IV. Show Description
This strain is homozygous for a deletion (gk1084) in ZK270.2, detectable by PCR using the following primers. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 179 bp. Deletion left flank: ATAATTTGCTAGTCTTTTTGGAATTTTTCT. Deletion right flank: GATTTAGGTATTTTAAAGTCGACGGACAAA. Validation: gk1084 passed by diagnostic PCR. No CGH probes for gk1084. Other deletions (gk3193, gkDf29) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2340 C. elegans W02D9.3(gk1128) I; rbf-1(gk3217) III; srh-145(gk3218) V. Show Description
This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2344 C. elegans C34D1.1(gk1133) B0462.4(gk3031) V. Show Description
C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2353 C. elegans F57A8.1(gk3231) V. Show Description
F57A8.1. Homozygous viable deletion, detectable by nested PCR. External left primer: GCAAGTCGAAGAAACTTCCG. External right primer: CAAAATGTCCATCATTCCCC. Internal left primer: TCCGTGCGAAATTATGTTCA. Internal right primer: AACCTTTCCGTTTCATCACG. Internal WT amplicon: 2669 bp. Deletion size: 2229 bp. Deletion left flank: GCAAAAAGTTGTTTCAATGCAGAATAATTT. Deletion right flank: ATATCAAATAAGCGGGATTAAGCGACTTAC. Insetion sequence at break: GCAGAATACATATTCATTAGATAAATA.Validation: gk3231 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807