C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.

bqSi142 [emr-1p::emr-1::mCherry + unc-119(+)] II. Might contain unc-119(ed3) in the background. Single-copy emr-1::mCherry transgene under control of emr-1 regulatory sequences. emr-1(gk119) embryos arrest when lem-2 is depleted by RNAi; bqSi142 fully rescues this phenotype. Reference: Morales-Martínez A, Dobrzynska A, Askjaer P. J Cell Sci. 2015 Feb 4.

Superficially wild-type.

Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

ZF-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.

ZF-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged AIR-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC

tagRFP-T and 3xMyc tags inserted into endogenous gip-1 locus. No overt phenotypes. RFP fluorescence is observed at microtubule-organizing centers, though generally much dimmer than the GFP allele gip-1(wow3). Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

ZF-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged PAR-6 protein to be degraded. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437. doi: 10.7554/eLife.64437. PMID: 34137371.

ZF-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP expression is observed in microtubules. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged TPXL-1 protein to be degraded. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.

ZF-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

GFP and 3xFLAG tags inserted into endogenous mzt-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(ok541); ceh-40(gk159) double mutants is rescued by muEx261.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP at C terminus + odr-1::RFP(su1006)]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261. ot406 has a dopaminergic phenotype.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261.

Delay in L4 to adult transition. Abnormal mitochondrial morphology.

Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.

Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.

F52B5.5. URL: http://www.celeganskoconsortium.omrf.org.

wyEx9745 [unc-86p::mCherry::PLCdeltaPH + odr-1p::GFP]. Pick GFP+ animals to maintain. zif-1(gk117) is a punitive null allele. mCherry expression in early PVD membrane. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

C16A11.6. External left primer: TCCACGGGAATTTCTACTGC. External right primer: CGCAAATTTTTCCGTGTTTT. Internal left primer: CTCCTTCAATCCAGCTTTCG. Internal right primer: AGACAATTCCGCCAACAATC. Internal WT amplicon: 3801 bp. Approximate deletion size: 1600 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: CGATAAATCGTTCGATTAGGGGGTTATCCGATGACCGAGTCATGAAATGT. Left deleted probe: CATAAACCGCCAAGGTTCGTGAATCCTGTGCGACGCCAACTTAAATTAGT. Right deleted probe: TGAAATTTCGAACCTTGAACTTCTTAAATGACTGGGGCAGCTCAAGAATA. Right flanking probe: AAAATGCGTGCGGCGCGTTGCAACTTAGCTCCGCCCACCCTTTGAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

F09E10.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2089.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33H2.1. Mutator (spontaneous mutations occur). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20C5.1. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08H9.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34G6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807