Search Strains

Heterozygotes segregate wild-type GFP+ heterozygotes, GFP+ Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Pick GFP+ wild-type to maintain. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.

mTurqoise2 tag with linker sequence inserted into endogenous his-72 locus. mNeonGreen::2xFLAG tag inserted into endogenous yap-1 locus. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells, deficiency of wts-1 (Warts/LATS) causes translocation into nuclei of all cell types observed. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::mNeonGreen::2xHA tag inserted into endogenous mig-15 locus. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of MIG-15 in somatic tissues. Auxin treatment causes locomotion defects, pVul, and weak Muv. Ubiquitous red fluorescence in cytoplasm. Ubiquitous mNeonGreen expression, some cytoplasmic, some localized to punctae and junctions. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Fakieh RA & Reiner DJ. Proc Natl Acad Sci USA. 2025 Jan 7;122(1):e2414321121. doi: 10.1073/pnas.2414321121. PMID: 39739816.

Mild uncharacterized Unc. reDf4 is a deletion of the tandemly duplicated cst-1 and cst-2 loci as well as intervening ncRNAs. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. mTurquoise2::2xMYC::AID* tag inserted into endogenous wts-1 locus. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of WTS-1 in somatic tissues. Auxin treatment causes growth delay. Auxin treatment coupled with wts-1(RNAi) causes L2 growth arrest. Ubiquitous red fluorescence. Blue WTS-1 fluorescence never detected. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657.

Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.

T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.

oxTi374 [unc-18(+) + ttTi5605 NeoR] V. oxEx1873 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi374 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in repressive region at position 3,339,184 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi176 [unc-18(+) + ttTi5605 NeoR] V. oxEx1807 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi176 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a generally permissive region at position 15,383,969 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi173 [unc-18(+) + ttTi5605 NeoR] V. oxEx1795 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi173 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a repressive region at position 17,523,246 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi357 [unc-18(+) + ttTi5605 NeoR] V. oxEx1876 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi357 is a Mini-Mos insertion of ttTi5605 mosSCI landing site in a repressive region at position 20,921,413 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi551 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. [NOTE (8-17-2016) One researcher has noticed an unusual segregation pattern of the oxTi551 insertion. This strain may contain more than one insertion or is possible mis-mapped - the authors recommend that you verify the location of this insertion prior to using it as a genetic marker.] Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.

oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]; inserted in Chr. I: 10,166,145. oxTi75 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] II; inserted in Chr. II: 5,448,544. oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] inserted in Chr. III: 6,076,837. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information.

oxTi76 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)]; inserted in Chr. IV: 11,899,008. oxTi405 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]; inserted in Chr. V: 15,838,568. oxTi421 [eft-3p::mCherry::tbb-2 3'UTR] inserted in Chr. X: 6,180,397. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information.

oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi179 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi444 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi177 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi365 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi354 [myo-2p::GFP::H2B + ttTi5605 + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals contain a myo-2p::GFP::H2B construct next to the insertion site and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi872 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-1.41). Insertion into C23G10.7 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi873 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.44). Insertion into ZK896.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi874 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-13.00). Insertion into srh-36. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi875 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: High percentage of males observed (unpublished observations, Chee Kiang Ewe, Rothman lab, UCSB). NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.19). Insertion into pro-3 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi876 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.53). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi877 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.02). Insertion into ggr-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi878 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.58). Insertion into B0507.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi879 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.02). Insertion into H24G06.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi880 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:1.82). Insertion into drp-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi882 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.13). Insertion into ncRNA C44B7.21. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi884 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.90). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi885 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:9.13). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi886 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-14.32). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi887 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:2.59). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi888 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. Pick GFP+ non-Unc to maintain. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.88). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi889 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.44). Insertion into F25G6.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi890 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-0.43). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi891 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-0.61). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi892 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.93). Insertion into srv-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi893 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:0.57). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi894 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.54). Insertion into srh-131. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.