Search Strains

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).

Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #245 (gga->gaa); amino acid #82 (G to E).

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

Homozygous or213 hermaphrodites make 100% dead embryos at 26C. No mitotic spindle assembly. Maintain at 15C.

[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.

Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(ar90) is a probable null mutation. Hermaphrodites are completely unable to lay eggs. Lineage defects in VPCs. Amber mutation (codon 197); amber suppressable. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(sy29) is a non-null allele. Hermaphrodites are 100% Egl but some eggs are seen on plates. Results from a missense mutation in codon 103. Do not distribute this strain; other labs should request it from the CGC.

Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC.

RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC.

DpyUnc. ar40 is a semi-dominant suppressor. At 25C ar40 suppresses the Egl phenotype of ne676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar40 suppresses proximal mitosis. ar40 does not suppress vulval lineage defects. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-5(ye121).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 24C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2..

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-6(ye143).

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094.

zuEx24 [hmp-1::GFP + unc-119(+)]. Animals with the duplication are WT. Occasionally pick green hermaphrodites to maintain. zuEx24 transmits at a very high frequency.

Heterozygotes are WT and segregate WT, DpyUnc and sterile hermaphrodites. Maintain by picking fertile WT hermaphrodites. q465 previously called mog-6. cyn-4 previously called cyp-4. Do not distribute this strain; other labs should request it from the CGC.

Temperature-sensitive allele of cyd-1. Phenotypically wild-type at 15C. At 25C, approximately one-third of q626 hermaphrodites were missing one distal tip cell (DTC) and approximately one-half of q626 males were missing the linker cell (LC). q626 also feminizes the XO gonad. q626 affects the production of SGP daughters in both sexes. There is also a maternal component since the mutant phenotype is almost fully penetrant in offspring of homozygous mothers, but less penetrant in offspring of heterozygous mothers. Reference: Tilmann C & Kimble J. Dev Cell. 2005 Oct;9(4):489-99.

Dpy. Cold-sensitive Fog phenotype; incompletely penetrant, even at 12C. Low percentage of sterile hermaphrodites with an Ooc phenotype. Do not distribute this strain; other labs should request it from the CGC.

Temperature-sensitive. Maintain at 15C. Female worms at 20C; hermaphrodites at 15C. GFP tag inserted at the N-terminus of the endogenous mei-1 locus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

Heterozygotes are WT and segregate WT, DpyUncs and Sterile Uncs. it145 is a recessive mutation that results in multiple rows of small oocytes instead of a single row of normal size oocytes. it145 is a recessive maternal effect lethal mutation: hermaphrodites produce embryos that fail to hatch - the embryos exhibit a partial defect in P0 nuclear rotation and a strong defect in P1 nuclear rotation; PAR proteins are mislocalized in P1.

Strain grows normally at 16C. Egg laying is slightly delayed at 20C. Hermaphrodites and males have a maternal effect, temperature-sensitive sterile phenotype at 25.5C. Therefore, L4s shifted to 25.5C will lay offspring, but the offspring will be 90-100% sterile.

Maintain at 15C. Semi-permissive at 20C. 100% lethal at 25C. cp21[hmr-1::gfp + LoxP] I males were crossed to WM179 nmy-2(ne3409) hermaphrodites. Fluorescence in early embryos, larvae, and adults. Severe cytokinesis defects in early embryos at 25°C. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

ku194 is a loss of function allele, likely to be molecular null. Connection of gonad defective, >95% Egl. Anchor cell and uterine seam cell do not fuse. Males can mate. Hermaphrodites are very difficult to mate. Previously called cog-2(ku194).

Heterozygotes are WT and segregate WT, sterile hermaphrodites (gld-1 homozygotes) and larvae that are often stuck in an old cuticle or have old cuticle attached to their posteriors (arrest by L4 stage).

Heterozygotes are WT and segregate WT, lin-25 homozygotes (which are temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless), and scc-3 homozygotes which are Pvl and Sterile (vulval morphogenesis defects and defects in sister-chromatin cohesion).

mCherry knocked into C terminal of vit-6 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-3 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-1 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

Temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless.

Slightly Unc. Long irregularly shaped tail. May be Egl. Many hermaphrodites (50%) have single small protrusion posterior to vulva, some gonadal abnormality and sterility.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

e1324 is a ts allele - animals are Dpy at 25C. Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture.

Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon.

At 20C about 50% of the hermaphrodites are Egl. Males have an abnormal tail and do not mate.

At 20C about 50% of the hermaphrodites are Egl.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, and Sterile Muv. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

Delayed gonadal and extragonadal development. Hermaphrodites (n=100), 74%

otIs541 [lim-6(intron4)::wCherry]. Red fluorescent reporter labels DVB neuron in males and hermaphrodites; also labels AVL, PVT, and 2 additional dim neurons in head. Hart MP & Hobert O. Nature. 2018; 553:165-170. PMID: 29323291.

otEx7353 [UPN::tagRFP::TRA-1(active) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Nervous system-specific expression of a TRA-1 gain-of-function construct. UPN is a concatenated panneuronal promoter (containing promoter fragments from unc-11, rgef-1, ehs-1, and ric-19). TRA-1(active) is a shortened version of the TRA-1A cDNA (860aa) predicted to encode the proteolytically activated version of TRA-1A generated by C-terminal cleavage in hermaphrodites (Schvarzstein and Spence 2006).

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.

mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.

Deletion of the Nuclear Localization Sequence (NLS; 220-235aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. No embryonic viability defect in hermaphrodites. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

tra-2(e2531eg) Enhanced gain-of-function. Dominant allele that transforms XO animals into hermaphrodites. PK125 is composed of phenotypically WT hermaphrodites.

Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC.