More Fields
Strain Species Genotype
GR2214 C. elegans sel-1(mg547) V. Show Description
Superficially wild-type.
GS807 C. elegans unc-32(e189) lin-12(n676n930) III; sqt-3(sc8) sel-1(e1948) V. Show Description
RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VS30 C. elegans hjSi158 I. Show Description
hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.
AN87 C. elegans sel-12(ty11) X. Show Description
Egl. Premature stop codon.
BR3417 C. elegans spr-5(by134) I. Show Description
Suppressor of Egl of sel-12.
CE1239 C. elegans hop-1(ep369) I; sel-12(ep6) spr-3(ep17) X. Show Description
ep369 is a weak allele. ep6 is a deletion allele. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS1214 C. elegans sel-12(ar171) unc-1(e538) X. Show Description
Egl. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS1894 C. elegans sel-12(ar131) X. Show Description
Egl. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS3012 C. elegans spr-1(ar200) V. Show Description
ar200 does not display any apparent phenotype. It suppresses the Egl defect of both sel-12(ar171) and sel-12(ar131), and displays genetic interactions with various lin-12 and glp-1 alleles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS307 C. elegans dpy-5(e61) cye-1(ar95)/unc-13(e51) I. Show Description
Heterozygotes are WT and segregate WT, Uncs and Sterile Dpys which have an everted vulva. ar95 previously called sel-10(ar95). See also WBPaper00004382. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS3165 C. elegans spr-1(ar205) V. Show Description
ar205 does not display any apparent phenotype. It suppresses the Egl defect of both sel-12(ar171) and sel-12(ar131). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS3754 C. elegans sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS776 C. elegans unc-32(e189) lin-12(n676n930) III; unc-42(e270) sel-11(ar39) V. Show Description
Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS878 C. elegans unc-32(e189) lin-12(n676n930) III; lon-3(e2175) sel-10(ar41) V. Show Description
Long. Unc. At 15C ar41 suppresses the 2 AC (anchor cell) phenotype of n676n930. (Strain GS878 does not contain sel(arX) and therefore does not suppress the Egl phenotype at 25C.) See also WBPaper00002966. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
LA59 C. elegans spr-3(by108) X. Show Description
Superficially WT. by108 completely suppresses the Egl defect of sel-12 mutants. by108 derepresses the transcription of hop-1 in the early larval stages. This strain may not be used for commercial purposes.
LA62 C. elegans byDf1 X. Show Description
Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.
LA95 C. elegans spr-4(by105) I. Show Description
Superficially WT. by1-5 strongly suppresses the Egl defect of sel-12 mutants. About 5% of spr-4(by105) I; sel-12(ar171) X double mutants are Egl. This strain may not be used for commercial purposes.
MT2236 C. elegans egl-1(n4065) V. Show Description
Egl. [10/02: This strain was previously listed as being sel-10(n1069) or egl-41(n1069); these were found to be incorrect and the mutation is now called egl-1(n4065). H. Schwartz comm.]
MT2244 C. elegans sel-10(n1077) V. Show Description
Egl. 5HT-S, IMIP-R. Mutation causes G567E coding change. n1077 previously called egl-41.
RB1432 C. elegans sel-10(ok1632) V. Show Description
F55B12.3. Homozygous. Outer Left Sequence: CAGTGACCATCGAACACCTG. Outer Right Sequence: TACGAGATCCGACTGCACAC. Inner Left Sequence: ATCAAGTGAACAAACGTGCG. Inner Right Sequence: AATACAGCCACCATTGCCTC. Inner Primer PCR Length: 3118 bp. Deletion Size: 901 bp. Deletion left flank: ATGGATGATGGATCGATGACACCGGAGGAC. Deletion right flank: TTAGTATTATCTTTTCAGAGACCGAGTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1672 C. elegans sel-12(ok2078) X. Show Description
F35H12.3. Homozygous. Outer Left Sequence: CCTCTTCCTCCTTTTCACCC. Outer Right Sequence: CGACAGTTGTGGTTTCCTCC. Inner Left Sequence: ACGTTTCAGATGCCTTCCAC. Inner Right Sequence: ATGATCCAGCGGGTACAAAA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1525 bp. Deletion left flank: TCTGGTTGTTTTTACGATGAACACGATTAC. Deletion right flank: TCAGCTGAATATATTTTGTTCATTTAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3824 C. elegans sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.