More Fields
Strain Species Genotype
MT1078 C. elegans egl-13(n483) X. Show Description
Egg laying defective. Makes bags of worms. Males mate.
MH1157 C. elegans him-5(e1490) V; egl-13(ku194) X. Show Description
ku194 is a loss of function allele, likely to be molecular null. Connection of gonad defective, >95% Egl. Anchor cell and uterine seam cell do not fuse. Males can mate. Hermaphrodites are very difficult to mate. Previously called cog-2(ku194).
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
MH1317 C. elegans kuIs29 V. Show Description
kuIs29 [egl-13p::GFP + unc-119(+)] V. egl-13 is the new gene name for cog-2. Transcriptional fusion of GFP to egl-13 gene. Nuclear localized. Bright expression in body wall muscles, expressed in uterine pi lineage, extensive neuronal expression. Note that a very low penetrance Cog phenotype is seen in this strain. Transgenes with egl-13 promoter can cause Cog phenotype. Conflicting map data: Wendy Hanna-Rose mapped kuIs129 to the left of dpy-11; Shi lab reported it close to gon-10 and unc-76.
MQD1779 C. elegans daf-2(hq63[daf-2::ICR::NLS::gfp::mNeonGreen::NLS]) III. Show Description
Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567.
SV1871 C. elegans swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
SV1930 C. elegans swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
SV2071 C. elegans he317[eft-3p::Lox2272::egl-13-NLS::tagBFP2::let-858 3'UTR::Lox2272::egl-13-NLS::mCherry::let-858 3'UTR] IV; heSi220 X. Show Description
heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.
SYS642 C. elegans ujIs113 II; egl-13(dev199([egl-13::mNeonGreen]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-13 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
VK2733 C. elegans vkEx2733. Show Description
vkEx2733 [nhx-2p::NLS-SV40::CemOrange2::NLSegl-13 + myo-2p::GFP]. Wild-type animals expressing NLS(sv-40)::CemOrange2::NLS(egl-13) under the intestinal-specific nhx-2 promoter. The dual NLS localizes to the nucleus. Pick animals with GFP+ pharynx to maintain. Reference: Thomas
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
RAF2181 C. elegans ieSi57 II; daf-2(bch-40[degron::3xFLAG::STOP::SL2::SV40::degron::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.