| CB5584 |
C. elegans |
mIs12 II. Show Description
mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3).
|
|
| PD4790 |
C. elegans |
mIs12 II. Show Description
mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.
|
|
| CB7272 |
C. elegans |
ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
|
|
| VC2003 |
C. elegans |
+/szT1[lon-2(e678)] I; mIs12 II; sec-3(ok2238)/szT1 X. Show Description
F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| CP175 |
C. briggsae |
nmIs12. Show Description
nmIs12 [Cbr-msrp-3(+) + Cbr-unc-119(+) + myo-2::GFP]. GFP expression in pharynx. Wild-type (non-Unc) movement. Roughly two-fold over-expression of Cbr-msrp-3(+); has no measurable effect on fertility. Cbr-MSRP-3 is a sperm surface glycoprotein with homologs in C. elegans and other species. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| AM1246 |
C. elegans |
rmIs126 X. Show Description
rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.]
|
|
| AUM1535 |
C. elegans |
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
|
|
| AUM1830 |
C. elegans |
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|
| AUM1863 |
C. elegans |
sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|
| AV1443 |
C elegans |
dao-5(ok542)/tmC18[dpy-5(tmIs1200)] I. Show Description
Heterozygotes are wild type with a green pharynx. They segregate Dpy, green pharynx, tmC18 homozygotes, and sterile, non-green pharynx, dao-5 homozygotes.
|
|
| CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
| CGC140 |
C. elegans |
goa-1(n499)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.
|
|
| CGC194 |
C. elegans |
dpy-26(n199)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Lethal/sterile dpy-26 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus n199 homozygotes (variable morphology). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Derived by crossing parental strains FX30140 with CB5101 (males).
|
|
| EU3115 |
C elegans |
klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
|
|
| EU3201 |
C elegans |
klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
|
|
| FX30123 |
C. elegans |
tmC24 [F23D12.4(tmIs1233)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30134 |
C. elegans |
tmC3 [egl-9(tmIs1228)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30135 |
C. elegans |
tmC3 [egl-9(tmIs1230)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30138 |
C. elegans |
tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30140 |
C. elegans |
tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Balancer marked with myo-2p::Venus. Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30161 |
C. elegans |
tmC16 [unc-60(tmIs1237)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::mCherry. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30167 |
C. elegans |
tmC18 [dpy-5(tmIs1200)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30168 |
C. elegans |
tmC18 [dpy-5(tmIs1236)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30177 |
C. elegans |
tmC20 [unc-14(tmIs1219)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. tmIs1219 is inserted in unc-14, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30179 |
C. elegans |
tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30186 |
C. elegans |
tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30194 |
C. elegans |
tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30203 |
C. elegans |
tmC25 [unc-5(tmIs1241)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30208 |
C. elegans |
tmC27 [unc-75(tmIs1239)] I. Show Description
Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30218 |
C. elegans |
tmC30 [ubc-17(tmIs1247)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30233 |
C. elegans |
tmC16 [unc-60(tmIs1210)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30234 |
C. elegans |
tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30236 |
C. elegans |
tmC30 [ubc-17(tmIs1243)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30240 |
C. elegans |
tmC24 [F23D12.4(tmIs1240)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30252 |
C. elegans |
tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X; tmEx4950. Show Description
tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30253 |
C. elegans |
tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X; tmEx4950. Show Description
tmIs1233 [myo-2p::mCherry, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::mCherry. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30262 |
C. elegans |
lin-42(tmIs1246) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::Venus. Egl. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30266 |
C. elegans |
lin-42(tmIs1226) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30269 |
C. elegans |
dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30273 |
C. elegans |
egl-17(tmIs1224) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::Venus. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30276 |
C. elegans |
egl-17(tmIs1234) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::mCherry. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| GR3055 |
C. elegans |
suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
| LE6273 |
C. elegans |
src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.
|
|
| LE6897 |
C. elegans |
src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.
|
|
| NJL3198 |
C. elegans |
skn-1(nic952)/tmC25[unc-5(tmIs1241)] IV. Show Description
Isoform-specific activation of SKN-1C. Heterozygotes are GFP+ and non-Unc. Segregates GFP+ non-Unc (heterozygotes), GFP+ Unc (tmC25 homozygotes), and GFP- non-Unc (skn-1 homozygotes). Eggs produced by skn-1(nic952) homozygotes do not hatch. Maintain by picking GFP+ non-Unc heterozygotes and checking for correct segregation of progeny. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.
|
|
| OH20145 |
C. elegans |
zfh-2(ot1709)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. zfh-2(ot1709) is a CRISPR/Cas9-engineered >30kb deletion of the entire zfh-2 locus. crRNA1: CTACCATTTAGCCAATATAT. crRNA2: GTAGTAGTAGTAGTATGAGG. ssODN: aaattcatccaaaaaaatttccagagttgccccgcccataCATACTACTACTACTACCACGACGACGCCATAAcaaaacc. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
|
|
| OH20425 |
C. elegans |
zfh-2(ot1787 *syb10278)/tmC20[unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Homozygous sterile mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Second homeodomain deleted from endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. ot1787 crRNA1: TCCTGCAACACGTCGTCCAG. crRNA2: CGGCGTTCTCACAAATCGAT. ssODN: ATGACACCGAGCACTCCTTCCTGCAACACGTCGTCCtcTGGACGAATCTATGAGAATCAGCCGAATCACGAGAGTTCtGATCGATTTGTGAGAACGCCGGGATCGAACTTTCAGTGC. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
|
|
| PD2557 |
C. elegans |
rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
|
|
| PD5994 |
C. elegans |
rps-23(cc5994)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
|
|
| PS7898 |
C. elegans |
C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|