| AV280 |
C. elegans |
unc-119(e2498) III; him-17(ok424) V; meIs5. Show Description
meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped.
|
|
| CB4845 |
C. elegans |
unc-119(e2498) III. Show Description
Small, severely uncoordinated. Spontaneous segregant from N2/RW7000 (Bristol/Bergerac) hybrid strain. Daf-d.
|
|
| DE90 |
C. elegans |
oxIs318 II; unc-119(ed3 or e2498) ruIs32 III; ddIs6 V; dnIs17. Show Description
oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.
|
|
| JA1334 |
C. elegans |
unc-119(e2498) III; weIs11. Show Description
weIs11[unc-119(+) + TAC-1::GFP].
|
|
| JA1354 |
C. elegans |
unc-119(e2498) III; weIs12. Show Description
weIs12[unc-119(+) + pie-1p::GFP::csnk-1].
|
|
| JA1403 |
C. elegans |
unc-119(e2498) III; weIs15. Show Description
weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.
|
|
| JJ1136 |
C. elegans |
unc-119(e2498) III; zuEx24. Show Description
zuEx24 [hmp-1::GFP + unc-119(+)]. Animals with the duplication are WT. Occasionally pick green hermaphrodites to maintain. zuEx24 transmits at a very high frequency.
|
|
| JR667 |
C. elegans |
unc-119(e2498::Tc1) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Superficially wild-type.
|
|
| KS411 |
C. elegans |
lin-17(n671) I; unc-119(e2498) III; him-5(e1490) V; mhIs9. Show Description
mhIs9 [lin-17::GFP]. Full length lin-17, expressed T.p cells. Rescues lin-17 mutants. unc-119(e2498) may no longer be in the background.
|
|
| MAH132 |
C. elegans |
rrf-1(pk1417) I; unc-119(e2498::Tc1) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
|
|
| PS4997 |
C. elegans |
unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|