Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BC13051 C. elegans dpy-5(e907) I; sEx13051. Show Description
sEx13051 [rCes F29D11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
MH210 C. elegans lrp-1(ku156)/gld-1(q266) I. Show Description
Heterozygotes are WT and segregate WT, sterile hermaphrodites (gld-1 homozygotes) and larvae that are often stuck in an old cuticle or have old cuticle attached to their posteriors (arrest by L4 stage).
LH191 C. elegans lrp-1(ku156) eqIs1 I; rrf-3(pk1426) II. Show Description
eqIs1 [lrp-1::GFP] I. eqIs1 is a spontaneous insertion of an lrp-1::GFP transgene extremely close to the endogenous lrp-1 gene that completely rescues lrp-1(ku156) Mlt and larval lethality. Reference: Kang YL, et al. Mol Biol Cell. 2013 Feb;24(3):308-18.
JDW789 C. elegans lrp-1(wrd320[lrp-1::mNG::3xFLAG]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the last exon of the endogenous lrp-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
KY5353 C. elegans tgDf1 I. Show Description
aBoc and Exp defective. Slow growth and small brood size. tgDf1 deletes aex-1 and lrp-1.
RG3316 C. elegans lrp-1(ve816[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.