| BAN545 |
C. elegans |
C03B8.3(bon104) III. Show Description
C03B8.3(bon104) is a CRISPR/Cas9-engineered 5 kb deletion. Genotyping primers: GATGTACGCTCACGCGAAAAATACG and AGCAAGAAGAGATCAAAACCATTTAATCACCAC. WT: ~5 kb; bon103: ~280 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045. |
|
| BAN547 |
C. elegans |
C03B8.3(bon104) III; tag-321(bon103) IV. Show Description
Derived form parental strains BAN544 and BAN545. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045. |
|
| DA869 |
C. elegans |
sqt-3(sc8) lin-25(n545) him-5(e1467) unc-76(e911) V. Show Description
Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8). |
|
| MH2294 |
C. elegans |
scc-3(ku263)/lin-25(n545) V. Show Description
Heterozygotes are WT and segregate WT, lin-25 homozygotes (which are temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless), and scc-3 homozygotes which are Pvl and Sterile (vulval morphogenesis defects and defects in sister-chromatin cohesion). |
|
| MT1175 |
C. elegans |
lin-25(n545) V. Show Description
Temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless. |
|
| MT20434 |
C. elegans |
chaf-1(n5453) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36. |
|
