More Fields
Strain Species Genotype
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC26 C. elegans dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC52 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III. Show Description
umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC86 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. Show Description
umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC92 C.elegans dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
EU1513 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; lin-2(e1309) X. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. or28 is a G to D mis-sense mutation at amino acid position 123.
EU1514 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV; lin-2(e1309) X. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. Strain produces a lot of males due to him-8(ec56). or28 is a G to D mis-sense mutation at amino acid position 123.
EU1515 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. Show Description
Him. or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123.
EU1516 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).
EU311 C. elegans dpy-5(e61) mom-5(or57)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys give only embryonic lethals which lack endoderm and make excess mesoderm. or57 is a recessive maternal-effect lethal.
EU407 C. elegans mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(e1489) IV; lin-2(e1309) X. Show Description
EU414 C. elegans unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal.
EU443 C. elegans unc-13(e1091) mom-4(or11)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or11 is a recessive maternal-effect embryonic lethal.
EU446 C. elegans unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal.
EU447 C. elegans unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(e1489) IV. Show Description
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal. Throws males.
EU452 C. elegans mom-5(zu193) unc-13(e1091)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozgyotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.
EU459 C. elegans unc-13(e1091) mom-5(zu193)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. Show Description
Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects.
EU927 C. elegans dpy-5(e61) mom-4(or49)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, Dpys which give only dead eggs and dead eggs.
HR1275 C. elegans src-1(cj293) dpy-5(e61)/hT2 [bli-4(e937) let-?(h661)] I; +/hT2 III. Show Description
Heterozygotes are WT and segregate WT, Dpy Mels and dead eggs.
HR492 C. elegans +/hT2 I; vab-7(e1562) mel-44(sb44)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Dominant ts maternal-effect embryonic lethal. Embryos arrest prior to morphogenesis or at two-fold. Non-ts recessive mid-larval lethal. Maintain at 15C. Freezes poorly.
KR2467 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
MT10996 C. elegans sqv-5(n3611)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, Sqv Mel, and dead eggs.
MT9647 C. elegans unc-29(e1072) sqv-5(n3039)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.
PS5527 C. elegans pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. Show Description
syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RG3068 C. elegans C25A1.16(ve568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Lvl. Deletion of 477 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve568 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTCACCCCCAATAAACCTATCAATTATCA ; Right flanking sequence: tcaggtttaaattagatttcttcgaatttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3085 C. elegans mrpl-34(ve585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3239 C. elegans trmt-6(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. ZK858.7. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3263 C. elegans F15D3.6(ve763[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3269 C. elegans F10G8.9(ve769[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3284 C. elegans eif-3.C(ve784[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Homozygous early larval lethal. Deletion of 2440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve784 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTCTGCTGAGCATACGACGACGCATTTCG ; Right flanking sequence: ttaaataataatttattatttaatcacaat. sgRNA #1: AATTCGCAACTAGCCATGTG; sgRNA #2: atctccgcgcaaatgcccac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3316 C. elegans lrp-1(ve816[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3363 C. elegans nsun-4(ve863[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 5392 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae, some larva mature into sterile dumpyish adults (ve863 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: AAGTATTCGGCTGGGCCTCCGCGGcgcatc; Right flanking sequence: CTAACTTTGGACCAATGTATATTTGCAAAC. nsun-4 sgRNA #1: AATATCGATTCGGAGACAGA; nsun-4 sgRNA #2: AGGGTAGAAACGGCACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3385 C. elegans plag-15(ve885[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Mel. Deletion of 1641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that give dead eggs (ve885 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: GGAAAAAGTGACACGAAATGGTTTGGAAAG; Right flanking sequence: CGGAAAAGTTTTCATGGGCTCCCGGATACT. plag-15 sgRNA A: CCTCCATCATCATACCCGAC; plag-15 sgRNA B: AGTATTTCAAGCTGATCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5003 C. elegans dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5018 C. elegans iars-2(gk5471[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5471 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4393 and CGC92. gk5471 is a 3877 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5019 C. elegans F28D9.4(gk5478[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5478 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4400 and CGC92. gk5478 is a 2626 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5020 C. elegans hrpr-1(gk5481[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5481 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4403 and CGC92. [NOTE: RG5020 and the parental strain VC4403 exhibit weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] gk5481 is a 2871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5021 C. elegans spcs-1(gk5510[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5510 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4435 and CGC92. gk5510 is a 735 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5022 C. elegans nola-3(gk5610[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5610 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4539 and CGC92. gk5610 is a 433 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGCTACTCAGCACGTGCCTATTATCCTCAC; Right flanking sequence: GCTGGTTTGGGAGTGGCGCCGCATGTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5023 C. elegans C45G3.3(gk5549[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5549 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4477 and CGC92. gk5549 is a 1227 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTGAACGCTCGCGCCACAATGTCATA; Right flanking sequence: ATTTTCCCTTGTTCTCTTGCTCACAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5024 C. elegans cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5632 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4561 and CGC92. gk5632 is a 1065 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG; Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5025 C. elegans F26E4.4(gk5646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5646 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4575 and CGC92. gk5646 is a 1524 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA; Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5026 C. elegans prp-4(gk5373[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5373 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4290 and CGC92. gk5373 is a 1874 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGGCCAGCAGCATCAGCACGCACCCGGG; Right flanking sequence: TGTCTTGGCGGTGCTGGAACAGCAAAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5027 C. elegans pbs-7(gk5705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5705 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4636 and CGC92. gk5705 is a 737 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACATGGAGATACTGAAACGCATCCTGCA; Right flanking sequence: TCAGCTGAACGGAAATTCAAACCTTGTAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5028 C. elegans ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5836 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4768 and CGC92. gk5836 is a 1235 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA; Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5029 C. elegans F30A10.9(gk5733[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5733 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4664 and CGC92. gk5733 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAACCAAACAATCATCAGCATATGTTCCT; Right flanking sequence: AATATCAGAAAAAATTTTTGCGAAAAAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5030 C. elegans gfi-2(gk5771[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5771 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4702 and CGC92. gk5771 is a 2938 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAAACTTCATCAATATCAATGAATCTGC; Right flanking sequence: TCACTCCTGGGTACTGAGTACCTTGACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7108 C. elegans E01A2.1(hd7099[loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7115 C. elegans F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7155 C. elegans apr-1 (hd7144 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.