More Fields
Strain Species Genotype
ADS1002 C. elegans aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
AGK587 C. elegans armEx227. Show Description
armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AMH82 C. elegans ccIs4251 I; ddi-1(ok1468) IV. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1.
AML10 C. elegans otIs355; otIs45 V. Show Description
otIs355 [rab-3::NLS::tagRFP]. otIs45 [unc-119::GFP] V. Pan-neural expression with no injection marker. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML14 C. elegans wtfEx4. Show Description
wtfEx4 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Pick RFP+ to maintain array. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML175 C. elegans lite-1(ce314) X; wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. Worms expressing the calcium insensitive fluorescent proteins GFP and tagRFP in the nuclei of all neurons in a lite-1(ce314) background. Control strain for AML70. Reference:
AML18 C. elegans wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. RFP and GFP expression in the nuclei of all neurons. AML18 acts as a control for the calcium imaging strain AML14. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML310 C. elegans wtfIs5; wtfEx258. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.
AML32 C. elegans wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517.
AML320 C. elegans otIs669 V; wtfIs145. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating wtfIs145. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790.
AML462 C. elegans otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790.
AML5 C. elegans otIs355 IV; lin-15B&lin-15A(n765) X; kyIs51. Show Description
otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. kyIs51 [odr-2b::GFP + lin-15(+)]. Pan-neuronal nuclear RFP expression. Cytoplasmic GFP expressed in the odr-2b neurons including AIZ, AIB, SIAV, AVG, RIV, ASG and IL2 neurons. Derived from parental strains QW1155 and CX3300. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML508 C. elegans unc-31(wtf502) IV; otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. unc-31(wtf502) is a CRISPR-engineered deletion allele. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790.
AML551 C. elegans gur-3(ok2245) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517.
AML554 C. elegans lite-1(ce314) gur-3(ok2245) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517.
AML70 C. elegans lite-1(ce314) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) background. Reference (wtfIs5):
ATU3301 C. elegans ccIs4251 I; aceIs1. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.
BN646 C. elegans bqSi640 II; bqSi470 IV. Show Description
bqSi640 [dpy-7p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi470 [hsp-16.41p::FLAG::NLS::FLP D5 + unc-119(+)] IV. Expression of red and green histones in hypodermal lineage before and after heat shock, respectively.
BW1932 C. elegans ctIs39. Show Description
ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53.
BW1935 C. elegans unc-119(ed3) III; ctIs43 him-5(e1490) V. Show Description
ctIs43 [dbl-1p::GFP + dbl-1p::GFP::NLS + unc-119(+)].
BW1946 C. elegans ctIs43 unc-42(e270) V. Show Description
Unc. ctIs43 [dbl-1p::GFP + dbl-1p::GFP::NLS + unc-119(+)].
CB5600 C. elegans ccIs4251 I; him-8(e1489) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Superficially WT hermaphrodites and males expressing GFP in nuclei and mitochondria of body wall muscles. Fluorescent body wall muscle nuclei can be seen by dissecting microscope with epifluoresence optics. Males mate poorly (ME 1/2). ccIs4251 mapped to LGI, + 2.5.
CB7272 C. elegans ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
CF2018 C. elegans muEx304. Show Description
muEx304 [lys-7p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2037 C. elegans muEx311. Show Description
muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2038 C. elegans muEx312. Show Description
muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2124 C. elegans muIs139. Show Description
muIs139 [dod-11p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2962 C. elegans muEx420. Show Description
muEx420 [hsp-12.6p::RFP(NLS) + odr-1p::RFP]. Pick RFP+ animals to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CGC12 C. elegans umnIs2 V. Show Description
umnIs2 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] V. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
CGC13 C. elegans unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC15 C. elegans umnIs4 III. Show Description
umnIs4 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] III. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC16 C. elegans hT2 [umnIs5] I; hT2 [bli-4(e937)] III. Show Description
umnIs5 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and tdTomato. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Derived by insertion of tdTomato transgene into parental strain KR1234 using CRISPR/Cas9.
CGC161 C. elegans mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC162 C. elegans mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC163 C. elegans mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC164 C. elegans mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC165 C. elegans mir-784(umn72[mir-784p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC166 C. elegans mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC167 C. elegans mir-787(umn74[mir-787p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC168 C. elegans mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC169 C. elegans mir-788(umn76[mir-788p+SL1::EGL13NLS::lox2272]) X. Show Description
CGC17 C. elegans unc-4(e120)/mT1 [umnIs6] II; dpy-17(e164)/mT1 [dpy-10(e128)] III. Show Description
umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.
CGC170 C. elegans mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
CGC171 C. elegans mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description