Dominant. Heterozygotes are Rollers. Temperature sensitive. At 25C: homozygotes are Sqt; heterozygotes are rollers. AT 16C: homozygotes are WT (a few adults may roll weakly); heterozygotes are WT. M-MATING+LOW TEMP ONLY.

Adults and L4 animals roll left. Recessive. M-MATING++ 1-10%WT. PKA rol-4.

ts

Viable Dpy at 15C. Extreme Dpy or L1 lethal at 25C.

Slightly dumpy. Variable cold-sensitive lethal (poor viability at 15C). Unusual missense allele (D297G) of sqt-3, suppresses dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.

Squat, dumpy at 15C. Inviable at higher temperatures. Deletion of most of sqt-3 coding sequence. Null by antibody staining.

Weak dumpy. Variable tail abnormal at 20C or higher. Cold-sensitive: most arrest as pretzel-stage embryos, with some escapers arresting as severely distorted L1 larvae at 15. Unusual missense allele (K280E) of sqt-3, cold-sensitive lethal and suppressor of dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.

Temperature sensitive roller. PKA rol-4.

Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.

Homozygous viable dpy. dpy-31(e2919) homozygotes are almost inviable, but lethality is efficiently suppressed by sqt-3(e2906). Reference: Novelli J, et al., Genetics. 2004 Nov;168(3):1259-73.

Heterozygotes are WT. Segregates WT, Sqt and Dead embryos (2-fold arrest). myo-3 Null. Maintain by picking WT.

Pick WT to maintain. Throws WT, Roller Uncs and dead eggs. wDf4 arrests as dead eggs with no gut. sc8 previously called rol-4(sc8).

Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.

Heterozygotes are Unc and segregate Unc, RolPar (adult homozygotes lay eggs that don't hatch) and dead eggs. nT1[unc-?(n754) let-?] is dominant Unc and recessive lethal. Strict maternal effect. sc8 previously called rol-4(sc8).

Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8).

Heterozygotes are WT and segregate WT, Rol Uncs, and dead L2 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

Dominant Egl. Unc. Dpy (ts). Throws males.

Roller. Long. Unc. XO Lethal. sc8 previously called rol-4(sc8).

jjIs1092 [(pNUT1) npp-1::GFP + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Heterozygotes are wildtype with GFP+ and mCherry+. lpin-1(ok2761) homozygotes die as L1 larvae. Also segregates Unc Rol.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).

mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.