Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Bivulva. Presence of cfz-2 was confirmed by PCR. mig-1 and lin-18 were confirmed by sequencing. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

e1324 is a ts allele - animals are Dpy at 25C. Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture.

Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon.

nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Homozygous viable. Deletion of 7573 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtttttccagttgctcacggtaccttca ; Right flanking sequence: gcgggtttggtgcggtttttacgtattcag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.