Search Strains

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.

Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.

umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

mCherry tag inserted at the C-terminus of the endogenous spin-1 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-2 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-3 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-4 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

The hemaglutinin (HA) epitope tag was inserted using CRISPR/Cas9 through homologous recombination. The nine amino acid HA epitope was placed between C. remanei (EM464) MSS-1 residues 22 and 23, one residue downstream of the predicted mature N-terminus after signal peptide cleavage. NOTE: nm74 was originally described as nmIs9. Derived from parental strain SB146. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.

nm77 is an HA epitope tag inserted into the endogenous Cbr-msrp-3 locus, two codons after the predicted signal peptide cleavage site of Cbr-MSRP-3. Anti-HA antibodies recognize the tagged Cbr-MSRP-3 glycoprotein on immunoblots, in the membranous organelles of spermatids, and on the plasma membrane of activated sperm (including pseudopod) in both males and hermaphrodites. To confirm presence of the nm77 insertion, use primers AT19+AT20 (WT: 291 nt, nm77: 318 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029

bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.

ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.

ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.

mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.

Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.

This endogenous tag on ATG-9 was made from a CRISPR event that used a method described by Dickinson et al. 2015 to efficiently insert GFP in replace of the stop codon of atg-9. Reference: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85.

uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. Pick fluorescent animals to maintain. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.

Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID* into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).

wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.

bmdSi338 [^SEC^lin-29p::FLP::p2A::H2B::2xmTurq2] I. qyIs225 [cdh-3p::mCherry::moeABD] V. Pick Rollers to maintain. Wild-type growth and movement. mNG tag inserted into endogenous lam-2 locus. Anchor cell-specific FLP for targeted protein degradation. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

T2A::sGFP2(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates sGFP2(1-10) from GLH-1 post-translationally so that sGFP2(1-10) disperses throughout germ cell nuclei and cytoplasm. sGFP2(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 16aa GFP11 or M3 sequence will bind sGFP2(1-10) in the germline and early embryo to emit GFP fluorescence. Broods from DUP223 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. [NOTE: (04/23/2021) The original stock received by the CGC was found to be carrying a second insertion, clu-1(sam131[GFP(11)::clu-1]. A new stock verified by to be carrying the correct transgene was received from DUP 05/04/2021.] Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 18aa wrmScarlet(11) sequence will bind wrmScarlet(1-10) in the germline and early embryo to emit wrmScarlet fluorescence. Broods from DUP237 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. Reference: Duong T, et al. Development. 2020 Mar 2;147(5):dev181727. doi: 10.1242/dev.181727. PMID: 32041790.

mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.

mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501

mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.

AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777.

mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

Unc. Not caused by cxTi10882. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). Grows best on HB101 bacteria. Reference: Frokjaer-Jensen C, et al., Nat Genet. 2008 Nov;40(11):1375-83.

egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi109 [mex-5p::GFP::pos-1(S199A, S210A, S216A, S237A & T242A) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi110 [mex-5p::GFP::pos-1(S199D, S210D, S216D, S237D & T242D) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi126 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] I. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).

egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of TOMM-20 tagged with Halo on the outer membranes of mitochondria in the germline and embryos. Reference: Fan X, et al. G3 (accepted).

egxSi144 [mex-5p::cox-4::halotag::pie-1 3’UTR + unc-119 (+)] II. Superficially wild-type. Stable expression of COX-4 tagged with Halo in the mitochondrial matrix in the germline and embryos. Reference: Fan X, et al. G3 (accepted).

egxSi145 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).