Strain Information

Name DA2100   View On Wormbase
Species C. elegans
Genotypeser-7(tm1325) X.
DescriptionLack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
MutagenUV/TMP
Outcrossedx10
Made byLeon Avery
Laboratory DA
Sign in or register an account if you want to order this strain.