| DA2100 |
C. elegans |
ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
|
|
| RB1585 |
C. elegans |
ser-7(ok1944) X. Show Description
C09B7.1. Homozygous. Outer Left Sequence: AGCGTTTCGCGTCATTAACT. Outer Right Sequence: GATCCACATGCCGAAAGACT. Inner Left Sequence: CCGAAAAGAAGTTCTCGCAG. Inner Right Sequence: GGCAAGAATGAAGAATGGGA. Inner Primer PCR Length: 3393 bp. Deletion Size: 1313 bp. Deletion left flank: TCAGAGTCATGAGGGTATGTAAGTTGACTT. Deletion right flank: ACAGATTCGGCAGACGGAGAAAAGTGAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VV207 |
C. elegans |
ser-7(vq2) X. Show Description
CRISPR/Cas9-engineered knockout of ser-7. Resistant to exogenous serotonin induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.
|
|
| DA2109 |
C. elegans |
ser-7(tm1325) ser-1(ok345) X. Show Description
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| CHS1086 |
C. elegans |
ser-1(yum1513) X; ser-4(yum1514) III; ser-5(yum1515) I; ser-7(yum1516) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| PHX1941 |
C elegans |
ser-7(syb1941[ser-7::T2A::mNeonGreen]) X. Show Description
Endogenous ser-7 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406
to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| PHX4502 |
C. elegans |
ser-7(syb4502[ser-7::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| SWF155 |
C elegans |
ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF302 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF380 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF420 |
C elegans |
ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF469 |
C elegans |
ser-5(tm2647) I; lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF800 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF911 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| OH13513 |
C. elegans |
otIs597. Show Description
otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain.
|
|