Search Strains

More Fields
Strain Species Genotype Add
EGD615 C.elegans cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
EL610 C. elegans smrc-1(om143[3xflag::smrc-1]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL629 C. elegans cid-1(om148[cid-1::3xmyc]) pup-2(om147[3xflag::pup-2]) II. Show Description
3xMyc tag inserted at C-terminus of endogenous cid-1 locus using CRISPR/Cas9. cid-1 also known as pup-1. 3xFlag tag inserted at N-terminus of endogenous pup-2 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL634 C. elegans met-2(om142 [3xflag::met-2]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Mutlu B, et al. Sci Adv. 2018 Aug 22;4(8):eaat6224. doi: 10.1126/sciadv.aat6224. PMID: 30140741.
EL658 C. elegans smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL661 C. elegans pup-3(om149[3xHA::pup-3]) I. Show Description
3xHA tag inserted at N-terminus of endogenous pup-3 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL662 C. elegans pup-3(om150[3xflag::pup-3]) I. Show Description
3xFlag tag inserted at N-terminus of endogenous pup-3 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL663 C. elegans smrc-1(om144[3xmyc::smrc-1]) met-2(om142[3xflag::met-2]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL716 C. elegans pup-4(om151[pup-4::3xflag]) II. Show Description
3xFlag tag inserted at C-terminus of endogenous pup-4/F43E2.1 locus using CRISPR/Cas9. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
EL732 C. elegans smrc-1(om145[3xmyc::smrc-1]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
ERC102 C. elegans ieSi57 II; smc-3(syb5520[smc-3::GGGGS::AID*::emGFP]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.
ERC103 C. elegans ieSi57 II; wapl-1(syb6035[wapl-1::GGGGS::AID*::emGFP]) IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. AID* and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX6035 with CA1200. Reference: Cahoon CK, Libuda DE. Conditional immobilization for live imaging Caenorhabditis elegans using auxin-dependent protein depletion. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506.
ERC82 C. elegans ieSi57 II; ers54[dpy-27::AID*::GFP] III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC83 C. elegans ieSi57 ers55[top-2::AID*::GFP] II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC84 C. elegans top-1(ers56[top-1::AID*::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ESC254 C. elegans dao-5(cse254[GFP::dao-5]) I. Show Description
GFP tag inserted into the N-terminus of endogenous dao-5 locus. maintain at 16-20C. Nucleolar GFP expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC319 C. elegans rpoa-2(cse319[degron::GFP::rpoa-2]) I. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the N-terminus of endogenous rpoa-2 locus. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC332 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC351 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC352 C. elegans qzIs15[rpoa-2p::AID*::GFP::rpoa-2] I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC360 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; emcSi71 IV. Show Description
emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC373 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC374 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC424 C. elegans tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC432 C. elegans grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the C-terminus of endogenous grwd-1locus. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC440 C. elegans reSi2 II; tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of TSR-2 in epidermal tissues. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC444 C. elegans reSi2 II; grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in epidermal tissues. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC716 C. elegans ida-1(cse716[ida-1:: wrmScarlet]) III. Show Description
mScarlet tag inserted into the C-terminus of the endogenous ida-1 locus. Maintain at 16-20C. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC770 C. elegans nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Maintain at 16-20C. Nucleolar mKate2 expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC794 C. elegans wrdSi23 cse772 [AID*::GFP::rpoa-2] I; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC795 C. elegans ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC796 C. elegans wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC797 C. elegans wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC818 C. elegans wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; set-2(ok952) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC825 C.elegans wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC829 C.elegans wrdSi23 I; unc-104(knu973[unc-104::AID*]) rpoa-1(cse829[rpoa-1::AID*::GFP]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at the C-terminus of the endogenous rpoa-1 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-1 and UNC-104 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
EU3121 C. elegans tac-1(or1955[gfp::tac-1]) II; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3169 C. elegans zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3201 C elegans klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
FGP3 C. elegans unc-119(ed3) III; fgpIs23. Show Description
fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FGP4 C. elegans unc-119(ed3) III; fgpIs24. Show Description
fgpIs24 [(pFGP77) pie-1p::GFP::TEV-S-Tag::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. When compared with strain FGP3, the difference in fluorescence signal corresponds to SUMO conjugation in FGP3. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FT2064 C. elegans hmg-5(xn107[hmg-5::gfp]) IV. Show Description
GFP-tagged HMG-5/TFAM labels mtDNA nucleoids. GFP tag causes a reduction in number of mtDNAs. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990.
GJ3452 C. elegans gcy-22(gj1976[gcy-22::GFP]) V. Show Description
GFP tag inserted into endogenous gcy-22 locus. GCY-22::GFP expression in the ASER neuron localized at cilium tip and PCMC. Reference: van der Burght SN, et al. Curr Biol. 2020 Nov 2;30(21):4299-4306.e5. PMID: 32916106
GL390 C. elegans aco-2(rf40[aco-2::GFP]) III. Show Description
C-terminal GFP tag inserted into endogenous aco-2 locus. ACO-2::GFP is a mitochondrial marker allowing the examination of native mitochondrial morphology in live animals. Reference: Begelman DV, et al. 2022 Jul 17;2022:10.17912/micropub.biology.000599. doi: 10.17912/micropub.biology.000599. eCollection 2022. PMID: 35903774
GLW16 C. elegans rab-7(utx12[mNG::rab-7]) II. Show Description
Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'
GLW19 C. elegans mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.