More Fields
Strain Species Genotype
DA2100 C. elegans ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
DA2109 C. elegans ser-7(tm1325) ser-1(ok345) X. Show Description
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.