Search Strains

GFP tag inserted at the C-terminus of the endogenous ceh-13 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.

GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.

bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.

zfIs149 [flp-18p(3kb)::mCherry::SL2::FLP-18 + lin-15(+)] X. FLP-18 expressing neurons are labeled with cytosolic mCherry. Overexpression of FLP-18 causes uncoordinated locomotion. Animals exhibit exaggerated head and body bends, increased reversal frequency, and enhanced calcium transients in body-wall muscle. These phenotypes are suppressed by loss of NPR-5. Reference: Florman JT & Alkema MJ. PLOS Genet. 2022 Mar 3;18(3):e1010091. doi: 10.1371/journal.pgen.1010091. PMID: 35239681.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1010 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttacgacccccgttttcaccctcattacca; Right flanking sequence: GGGTGAAGAAGGTCAACGGCCAAAGGCATt. rps-27 crRNA A: atcattggctgtctcgtctc; rps-27 crRNA B: TGATCTCCCTTTGTGGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Early larval arrest. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1011 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatcattaaaaacattgccaacagttgaa; Right flanking sequence: AGgtatatataaaacttattatactaaacg. sars-1 crRNA A: aaacagtatcgaagttaagG; sars-1 crRNA B: GACCAAGAAACTGAGTGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6547 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcccccaaaaagttttgtttcgtatccca ; Right flanking sequence: TGGGAGAATTGGAATGGATTTGATGGTGCC. twk-39 crRNA A: ctgatcgaacctaaagatgg; twk-39 crRNA B: GAGCTTGGCTGTTCTCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGAAAATTGGCTAACCGATACACGCCT ; Right flanking sequence: AGGCTTTGCGATCAACCTGAAATACATCCT. glct-5 crRNA A: TTCTGAAGATCGCAAAGTGC; glct-5 crRNA B: CGATTTGCAGTAGACATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Maternal effect lethal. Deletion of 5068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve1014 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTGCTCTGTGAGCCACTTCTCATCAATCT; Right flanking sequence: TGGTGTCAACGACCTGATGGGTATAGCGTA. K10C3.5 crRNA A: CATTGATAGTCCGGGACACG; K10C3.5 crRNA B: ACTGTTTCATTCACGTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1015 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATCGCCACTTCTAAACCTTCTTTTCCGTG; Right flanking sequence: tggtcggagaaaatcctcggccacccggcc. yars-2 crRNA A: CACAATTCGAGTAATTTCGG; yars-2 crRNA B: ttccacaaaactccgcgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATCAGTTGTCAAAGCAGTGCGAGAAGCT ; Right flanking sequence: TTAACGCACGTTGTTTGTACAGTCCAAGAG. C55A6.10 crRNA A: TGTTGCAGAAACTGGAGACC; C55A6.10 crRNA B: AAAAATGCGGAAAAATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Late larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow moving larvae (ve1017 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ATTTTAAATATGGAGTAATTTAGGATGCCA; Right flanking sequence: CGGTGGTTTTGTTTTCTTCGGTGCCTATGA. slc-25A26 crRNA A: ACCACCGATCCTTCTTCTGA; slc-25A26 crRNA B: CGTGTAATGTGGATTTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Emb. Deletion of 3962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve1018 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATAGACTACTATTTGAAGGCTAACTTTCCA; Right flanking sequence: AGGAATTGTGattttatttaaattttgttt. D2045.9 crRNA A: ATTTCCCGGTCAACGCAACG; D2045.9 crRNA B: GACACCGAAACCTAAAAGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1019 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ACTTATCGAACGATTTTGTGGTTCATGCCA; Right flanking sequence: TGGAAACAAAAATATTTGAGATGGAAGGAA. idha-1 crRNA A: TCGCTTTACTCCTATCCCAT; idha-1 crRNA B: TTGCCAAGCATTCTGAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, SmaUnc and animals with a posterior half that is thin, pale, uncoordinated.

mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663.

CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

az122 is an I371F missense allele of dxbp-1 and presumptive null. It suppresses unc-73(e936) by promoting cryptic splicing of an intron beginning with UU. az122 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). smg-4(az152) provides an NMD deficient background allowing maximization of alternative splicing changes by 1nt by mRNA-Seq. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Can be used in conjunction with tissue-specific TIR1-expressing lines to degrade RAGA-1 protein via the Auxin Inducible Degron system. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195

Auxin-Inducible Degron (AID*) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.

Unc. Reporter for no-go mRNA decay. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369.

3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369

3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369

srf2119 is a 965bp deletion within znf-598. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369

srf730 is a 900bp deletion within hbs-1. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369