umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1124 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Pvl GFP+ non-mKate2 (ve542 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: GTTTTATGATGCTCTTCAATTCTACCGGAC ; Right flanking sequence: GCTGGTGCACCGGCTCCAGCTCCAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Lvl. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, arrested GFP+ non-mKate2 larvae (ve561 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cgatcagtttgaaatccataggaaagtttc ; Right flanking sequence: GAATCCAGAATAAAGGCTGAATGGTATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.  Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1747 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve617 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATGGTAACTCGCTCAAGTCCGATGCCTCCT ; Right flanking sequence: TGGAGAGTTTTGGTTGTTCACCTTCGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1981 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve619 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTCTCTTCAACTGCTGTCTCAGCTCTATT ; Right flanking sequence: tagctccacccacattttttgtgacgtcac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 most are sterile adults, but escapers do lay small broods (ve625 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tggaaaataactgaggacacttattgctac ; Right flanking sequence: tttggatcgataaaacacacaatcggtgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve628 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atgtttttttcatagaaataacaaactttt ; Right flanking sequence: caccctccgatgttcttcctgttttctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve635 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAAAGTGTGCCATGCAAAACATCAGAAA ; Right flanking sequence: GTAGATAAGCTGGTTGCCGAGGGAAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve636 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaagatcaaaagttgaacagggagaacat ; Right flanking sequence: gggacttgaattttcggagaaagaagacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 2064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve641 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: caatgcgcctacatgcctacctacatgcca ; Right flanking sequence: AGGCTCATTTTCAAAATAGAATATCCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve644 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tacgcaaacatgacacctgacgacatttca ; Right flanking sequence: GTGGGAAATTCGCTCCAAAACACGAAGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, slight Dpy. Deletion of 1939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 slight Dpy sterile adults (ve648 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acggttaattgaaaatgctccgcccccgaa ; Right flanking sequence: GTTGGGATGCTTCAAAAAGTCGGACAAAAT. sgRNA #1: cctaacgagagccatggttc; sgRNA #2: GTCCGTCACTTGAAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are egg-laying defective, unhealthy. Deletion of 9372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 Egl-d adults (ve658 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgataatttaataaaacctctattccagtc ; Right flanking sequence: CGGACACCTTCCAGGACGGCGACGTCTCCA. sgRNA #1: tctgcatcagaccgaaattc; sgRNA #2: TAAATTCGAAATCCGGGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are slow growing, Mel. Deletion of 2999 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve664 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaacctcccgaTTAGGTGTTAGTAGTGTCG ; Right flanking sequence: ggggaacactcattgatttaaatcatgatt. sgRNA #1: ATGAAAGTAGTAGTGACGAC; sgRNA #2: gcaaaaaaacacaatctcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve670 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aagatccagcttaggttcagttaacgcggc ; Right flanking sequence: tatggaatttttcagatttttctccaaaaa. sgRNA #4: GGATACTTCCATGTATCCCA; sgRNA #5: AACGTCGAATAATAGCGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, Dpy. Deletion of 866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile Dpy adults (ve671 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaggctgaatttttgcttgagaatttctg ; Right flanking sequence: ctcggcattttccacacaatctatttattt. sgRNA #1: tttgcttgagaatttctgga; sgRNA #2: atcatttccattaatttcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve674 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atagagaaacggcaaggtcatttacctggc ; Right flanking sequence: TCTGGAAAGTGTGATTTCTGAGATGGATCA. sgRNA #1: tgtgtggatgagaaaaggcc; sgRNA #2: GGGAAAAACGCAGAATGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest w/ a few escapers. Deletion of 1011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve678 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aattaatttctccgaatttcagATGTCCCA ; Right flanking sequence: GGGGAATTATTTAAttgattttttgcagtt. sgRNA #1: GTGCAACTGTATCGTACTCG; sgRNA #2: CAGTGGACTTGAGGAGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 2917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve680 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gcgcttgcaacgacgctccgttctcccgca ; Right flanking sequence: tctccgtgttttctggtggtttttgccgat. sgRNA #1: actctaaacaacacccatgc; sgRNA #2: accagaaaacacggagagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Y54H5A.1. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1630 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve681 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GTCCGGTGAAAATGACGTTGAAATGCATGA ; Right flanking sequence: TATGGGTCAGAATGAGGTCAAAGAAGTTCA. sgRNA #1: TGACGTTGAAATGCATGATG; sgRNA #2: ACAGCTGATGTTCGTCCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 12039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve690 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cacttgcagtttccgcttgatcacccaaat ; Right flanking sequence: cccgggtacgcgtccttctcaccgacaaac. sgRNA #1: ccgcttgatcacccaaatta; sgRNA #2: gtatacctcattcgcccacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve698 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctttggagaaggggaaaacaccttctagt ; Right flanking sequence: GACGGCGAGCAGCATgaagaacagtaatac. sgRNA #1: gggaaaacaccttctagttt; sgRNA #2: CTGCTGAGCCGACTCGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Emb. Deletion of 430 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve726 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttgcttaaattacttgtgtccttca ; Right flanking sequence: GGGAGGCGTGGACGGAGAAAACGAG. sgRNA #1: agggatatcgaaaatagtga; sgRNA #2: TGCAACAACGTTCTCTACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 6712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve745 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgggaataattttctctcgaatcaatatct ; Right flanking sequence: tttaattttttaaagttaaaaattttctag. sgRNA #1: atgaaacttgcacttcaccg; sgRNA #2: aagcggagtcgggaagaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest. Deletion of 375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve759 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ctcagttatgtgtgaatgttatcagtttta ; Right flanking sequence: TGGATATAGTGGATCGCAACCACTCTGCGA. sgRNA #1: cagaATGCGGATAACTCAAT; sgRNA #2: GTTTACGCATGGTGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval lethal or sterile. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 larvae (ve767 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atggtgtttcatgagaaatgtggctctccc ; Right flanking sequence: TTGACAATCAATACAGCTGAAAGTAGTATT. sgRNA #1: tgaactcacacaatttcacc; sgRNA #2: CTTGTCTACACgtaagcttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve768 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tTCATTTCTTCTCCTTTTTCTCCTTATCCA ; Right flanking sequence: aaaatataatttatgccagtaatgagtatc. sgRNA #1: CGAGAGGATACAGAAAAGAG; sgRNA #2: cgaaattcatgtcacgagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Mes. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 viable adults that produce progeny most of which are sterile (ve777 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTTCTTGAGCTTCATCGTCATCGAATCCG ; Right flanking sequence: TGGATTATCCATttttgaactgaaaattca. sgRNA #1: AAAATTATCAGCGAGGGAGA; sgRNA #2: AATAAGTCGATTTCTTTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 9240 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve783 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gagacaaataaaaagcgagagagggagagg ; Right flanking sequence: tggcccgaaatttatatcaattttgcggac. sgRNA #1: tggtgatggattggtgatgg; sgRNA #2: agcgcacacacaaacacaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. C56G2.3. Homozygotes arrest as late larvae or become sterile adults. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve789 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acttctggactttaattcccttacctatta ; Right flanking sequence: aggtgaagctgagcgtggcaactcacttca. sgRNA #1: cccagtgacgatattgagat; sgRNA #2: tttctctagctctttcagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest/sterile. Deletion of 3348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae/sterile adults (ve818 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCAGCGAAGAGATGAAGAGTATATTGAAGA ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: TATTACAGAAAGATTGAGCA; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve819 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGTTGATCAACACGCTATTTCACTTGGACC ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: ACTTCCAGCAAATGAGGTTG; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve900 homozygotes (larval arrest), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCCAGGTTGGTGGAAGCTGACGCTTGGTCT; Right flanking sequence: ACCCATGGTTGATGCGGATTACCTGAAAGA. rps-13_C16A3.11 sgRNA A: TGTAGTATCTAGCCAAACGG; rps-13_C16A3.11 sgRNA B: CGCATGCACAATCCAGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Arrested larvae. Deletion of 1712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested early-stage larvae (ve952 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tttccacactcagtcccccctgctctgccg; Right flanking sequence: CTCAAGGGAGTCGAAGACGGAGAAGGCATG. mlc-3 sgRNA A: atgtgtgagtgttgcagcgg; mlc-3 sgRNA B: GAGCTCATCGGCCTCATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve962 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CAATAAAATTCGATTGCTGATAGCGTCACA; Right flanking sequence: CTCTCCTCGCCTGGTACTTTACCAACGAAC. ndub-8 sgRNA A: AGACCGGTTCACGTGATAGG; ndub-8 sgRNA B: CCATCGGTACGAGCACGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Embryonic lethal. Deletion of 1942 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, dead embryos (ve982 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AATGTGTACTCAATATTGACTTGGACTCCA; Right flanking sequence: CATGAGCAGGAAAAACTTTTTTGGCAGGCA. copd-1 crRNA A: TGGCCTCAAGAATCATCTGA; copd-1 crRNA B: GCCTAAAACTACCCTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve984 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: some, but not all balanced heterozygotes display vulva phenotypes such as blips, explode at vulva, and/or egl. Left flanking Sequence: TGTTCTTCATGAAGATAAAAAGTACTATGC; Right flanking sequence: TGGAGGTCAGATGATCCCAACTGCACGCCG. eftu-2 sgRNA #1: TACAGCTCTCGAAGTATACG; eftu-2 sgRNA #2: ACAGAACCACTTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve985 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CACGGTTCAAGAAGTCGGTTCTGCACTTGG; Right flanking sequence: aggaacaaaaatgtaaaacaatttgccgag. rpl-21 crRNA A: ATGGCTTGATGTGCTCGATA; rpl-21 crRNA B: tgtcaatatagagaactacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5467 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4389 and CGC66. gk5467 is a 2935 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5476 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4398 and CGC66. gk5476 is a 1853 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5482 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4404 and CGC66. gk5482 is a 2468 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.