Strain Information
| Name | UP4013 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | bli-4(cs281) I; csEx919. |
| Description | csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Susanna Birnbaum |
| Laboratory | UP |
| Reference | Birnbaum SK, Cohen JD, Belfi A, Murray JI, Adams JRG, Chisholm AD, Sundaram MV. The proprotein convertase BLI-4 promotes collagen secretion prior to assembly of the Caenorhabditis elegans cuticle. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936; PMCID: PMC10538796. |
Sign in
or
register an account if you want to order this strain.