dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I.

This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

[NOTE: Please see RG5003 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.