Strain Information
| Name | PHX5321 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | bli-4(syb5321[bli-4::SfGFP(int)]) I. |
| Description | bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | SUNY Biotech |
| Laboratory | UP |
| Reference | Birnbaum SK, Cohen JD, Belfi A, Murray JI, Adams JRG, Chisholm AD, Sundaram MV. The proprotein convertase BLI-4 promotes collagen secretion prior to assembly of the Caenorhabditis elegans cuticle. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936; PMCID: PMC10538796. |
Sign in
or
register an account if you want to order this strain.