Strain Information

Name PHX5321   View On Wormbase
Species C. elegans
Genotypebli-4(syb5321[bli-4::SfGFP(int)]) I.
Descriptionbli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
MutagenCrispr/Cas9
Outcrossedx0
Made bySUNY Biotech
Laboratory UP
Reference Birnbaum SK, Cohen JD, Belfi A, Murray JI, Adams JRG, Chisholm AD, Sundaram MV. The proprotein convertase BLI-4 promotes collagen secretion prior to assembly of the Caenorhabditis elegans cuticle. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936; PMCID: PMC10538796.
Sign in or register an account if you want to order this strain.