Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
HBR3216 C. elegans lgc-38(goe13[flp-11p::XCaMP-R::flp-11 3’UTR] *syb2346) III; flp-11(syb6321[flp-11::sfGFP] *syb714) X. Show Description
sfGFP tag inserted at C-terminus of endogenous flp-11 locus. FLP-11sfGFP translational reporter is visible in RIS and together with XCaMP-R allows visualization of RIS activity and FLP-11 release. [syb6321 sgRNA1: GCTACCATAGGCACCACGAGCGG.] [goe13 dpy-10 crRNA: Gctaccataggcaccacgag. trRNA: aacagcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.] Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
PHX2493 C elegans lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3’UTR] syb2493[ReaChR::linker::mKate2]) III. Show Description
ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX3190 C elegans lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3’UTR] syb3190[unc-58(e665)::linker(GSGSGSGSG)::mKate2]) III. Show Description
flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX6265 C. elegans lgc-38(syb6265[flp-11p::FLP D5::FLP-11 3’UTR] *syb2346) III. Show Description
(III:7007600). FLP D5 recombinase driver expressed from the flp-11 promoter. The flp-11p::FLP driver consistently causes recombination in RIS, as well as in several other cell types. It is more penetrant but less specific than srx-9(syb7929[srx-9::SL2::FLP D5]). Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX7929 C. elegans srx-9(syb7929[srx-9::SL2::FLP D5]) V. Show Description
FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.