| AH205 |
C. elegans |
sdn-1(zh20) X. Show Description
Slightly Unc. Variably Egl. zh20 is a deletion in sdn-1. The sequence of the breakpoint is: TTTGCTTCACAC//zh20//GTCGACAGGCAG. |
|
| AUM1880 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768. |
|
| AX7884 |
C. elegans |
pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)
encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.
Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. |
|
| BB239 |
C. elegans |
adr-1(uu49) I; adr-2(uu28) III. Show Description
Chemotaxis deficient. Transgenes are silenced in this background. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. NOTE: In the referenced publication, irregularities were noted in the adr-1(gv6);adr-2(gv42) null strain, which were ascribed to background mutationsint hat strain. This strain -- adr-1(uu49);adr-2(uu28) -- was generated Crispr/Cas9 targeted mutation and phenotypes are more consistent with another null strain, adr-1(tm668);adr-2(ok735). |
|
| BN477 |
C. elegans |
bqSi471 II; bqSi225 IV. Show Description
bqSi471 [hsp-16.41p::FRT::mCherry::his-58::FRT::peel-1 + unc-119(+)] II; bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. Expression of emr-1p::emr-1::mCherry marker is visible, but faint. Suitable for spatiotemporal cell ablation by crossing with FLP-expressing strains. |
|
| CA388 |
C. elegans |
pch-2(tm1458) II. Show Description
Defective for meiotic synapsis checkpoint. Recessive. |
|
| CB1490 |
C. elegans |
ali-1(e1934) him-5(e1490) V. Show Description
Faint or invisible alae in L1. Segregates males. |
|
| CER240 |
C. elegans |
prp-8(cer22[R2303G]) III. Show Description
Partial loss of function allele. prp-8(cer22[R2303G]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495 |
|
| CER248 |
C. elegans |
snrp-200(cer24[S1080L]) II. Show Description
Partial loss of function allele. snrp-200(cer24[S1080L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495 |
|
| CER256 |
C. elegans |
snrp-200(cer23[V676L]) II. Show Description
Partial loss of function allele. snrp-200(cer23[V676L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Reduced brood size, slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495 |
|
| CF1139 |
C. elegans |
daf-16(mu86) I; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped. |
|
| CG1438 |
C. elegans |
egl-2(rg444) him-5(e1490) V. Show Description
rg444 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the EGL-2 K+ Channel in N2 background. Faint YFP fluorescent puncta can be detected on muscle membranes and neural cell bodies and processes at high power magnification in all stages. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955 |
|
| COP1626 |
C. elegans |
ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
|
| COP1863 |
C. elegans |
goa-1(knu751) I. Show Description
Hyperactive, protruding vulva. knu751 is an A221D point mutation associated with GNAO1-associated epileptic encephalopathy. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
|
| COP1918 |
C. elegans |
rskn-1(knu796) I. Show Description
Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
|
| COP2002 |
C. elegans |
K09E4.4(knu858) II. Show Description
knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
|
| COP2004 |
C. elegans |
agl-1(knu860) II. Show Description
Superficially wild-type. knu860 is a W1044X point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
|
| COP2008 |
C. elegans |
agl-1(knu864) II. Show Description
Superficially wild-type. knu864 is a S1444R point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
|
| CX4103 |
C. elegans |
kyIs150 IV; sax-1(ky491) X. Show Description
kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg
ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
|
| CX6448 |
C. elegans |
gcy-35(ok769) I. Show Description
668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'. |
|
| CZ3714 |
C. elegans |
gcy-31(ok296) X. Show Description
2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele. |
|
| CZ3715 |
C. elegans |
gcy-33(ok232) V. Show Description
1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. |
|
| CZ793 |
C. elegans |
vab-1(e2027) II; lin-15B&lin-15A(n765) X; juIs24. Show Description
juIs24 [vab-1::GFP + lin-15(+)]. GFP very faint. Overtly WT. |
|
| DF64 |
C. elegans |
nyDf1(ny15) IV; him-5(e1490) V. Show Description
Deficiency covers at least all of cosmid T23G4; right breakpoint may be in cosmid C47A4. Fails to complement tlp-1(bx85). Viable and fertile. Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. |
|
| DPB2312 |
C. elegans |
mir-43(sjm2) II. Show Description
Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170. |
|
| DPB2313 |
C. elegans |
mir-43(sjm3) II. Show Description
Homozygotes lack gross phenotypes. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between miR-42* and miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170. |
|
| DPB2315 |
C. elegans |
mir-43(sjm2) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170. |
|
| DPB2316 |
C. elegans |
mir-43(sjm3) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between mir-42* and mir-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm3) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170. |
|
| EW45 |
C. elegans |
smg-1(e1228) I; unc-30(e191) IV; deIs1. Show Description
deIs1[unc-30(+) + lin-39TL::GFP (yeast DNA)]. A translational fusion of GFP to the C terminus of LIN-39. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint. |
|
| EW61 |
C. elegans |
dpy-20(e1282) IV; him-5(e1490) V; deIs4. Show Description
deIs4 [ajm-1::GFP + GFP::lin-39(YAC) + dpy-20(+)]. A transcriptional fusion of GFP to the ATG of lin-39, with a stop codon between GFP and LIN-39 sequences. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint and may get fainter over time. Freeze upon receipt. |
|
| EW62 |
C. elegans |
smg-1(e1228) I; dpy-20(e1282) IV; him-5(e1490) V; deIs4. Show Description
deIs4 [ajm-1::GFP + GFP::lin-39(YAC) + dpy-20(+)]. A transcriptional fusion of GFP to the ATG of lin-39, with a stop codon between GFP and LIN-39 sequences. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint and may get fainter over time. Therefore, freeze upon receipt. |
|
| FAS32 |
C. elegans |
his-74(uge16[gfp::his-74]) V. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FAS34 |
C. elegans |
his-74(uge18) V. Show Description
Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FAS43 |
C. elegans |
his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FAS46 |
C. elegans |
his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FAS47 |
C. elegans |
his-70(uge31[gfp::his-70]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FAS65 |
C. elegans |
his-69&his-70(uge44) III. Show Description
Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FAS84 |
C. elegans |
his-71(uge45[gfp::his-71]) X. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print]. |
|
| FX30197 |
C. elegans |
tmC25 IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) One breakpoint is in unc-8, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
|
| GH378 |
C. elegans |
pgp-2(kx48) I. Show Description
Reduced number of birefringent gut granules in embyros and a mislocalization of birefringence to the lumen. Faint autofluorescent gut granules in adults. |
|
| GR1321 |
C. elegans |
tph-1(mg280) cam-1(vs166) II. Show Description
Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation. |
|
| HBR546 |
C. elegans |
goeIs102. Show Description
goeIs102 [aptf-1 5'UTR::ChR2::mKate2::aptf-1 3'UTR + unc-119(+)]. Superficially wild-type. This strain carries an optogenetic transgene that can be used to send worms to sleep immediately at any given time point. Reference: Turek M, et al. Curr Biol. 2013 Nov 18;23(22):2215-2223. |
|
| HC726 |
C. elegans |
sid-1(qt95) V. Show Description
Sid. Hypomorhic allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917. |
|
| HC970 |
C. elegans |
sid-1(qt78) V. Show Description
Sid. Deletion allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917. |
|
| HE115 |
C. elegans |
unc-100(su115) I. Show Description
Slow. Slightly Dpy. Recessive. Grows fairly well. Body Muscle abnormal. Sarcomeres faint. |
|
| HE2000 |
C. elegans |
unc-15(su2000) I. Show Description
Paralyzed Unc. Super Slow. Body Muscle Abnormal. Sarcomeres faint. |
|
| HW1329 |
C. elegans |
lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
|
| IG256 |
C. elegans |
xnp-1(tm678) I. Show Description
Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59. |
|
| JBL1 |
C. elegans |
tonSi1 II; unc-119(ed3) III. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. Maintain at 20-25C. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press. |
|
| JBL2 |
C. elegans |
tonSi1 II; unc-119(ed3) III; ddIs6 V. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Maintain at 20-25C. Derived by crossing JBL1 and TH27. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press. |
|