Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AFS205 C. elegans zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
AFS222 C. elegans zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
ANR165 C. elegans eif-2alpha(rog3) I. Show Description
eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896.
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
BK204 C. elegans qpIs96. Show Description
qpIs96 [exc-9p::mCherry::cdc-42]. Expression of mCherry-tagged cytoplasmic CDC-42. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK206 C. elegans qpIs98. Show Description
qpIs98 [exc-9p::mCherry::glo-1]. Expression of mCherry-tagged GLO-1 of lysosomes in cytoplasm of excretory canals along nearly entire length of worm. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK210 C. elegans qpIs100. Show Description
qpIs100 [exc-9p::mCherry::rab-7]. Expression of mCherry-tagged RAB-7 of late endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK220 C. elegans qpIs103. Show Description
qpIs103 [exc-9p::mCherry::GRIP]. Expression of mCherry-tagged mammalian GRIP of Golgi in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BR5270 C. elegans byIs161. Show Description
byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. PMID: 22611162.
BRC546 C. elegans antIs30 II; unc-119(ed9) III. Show Description
antIs30 [attP-f + Cbr-unc-119(+) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. antIs30 was inserted into ttTi5605 on LG II using MosSCI. GFP expression in pharynx is very weak (as it is single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BRC566 C. elegans antIs31 II; unc-119(ed9) III. Show Description
antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BW1927 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
CA998 C. elegans ieDf2 [unc-119+]/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.
CF1380 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF2060 C. elegans daf-16(mu86) I; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CFJ302 C. elegans unc-119(kst33) III. Show Description
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)
CGC10 C. elegans umnTi7 IV. Show Description
umnTi7 [eft-3p::GFP::H2B + unc-119(+)] IV. Integration site: (IV:+14.35 cM/nt 15,997,713). Might still contain unc-119(ed3) in background.
CGC4 C. elegans umnTi1 III. Show Description
umnTi1 [eft-3p::GFP::H2B + unc-119(+)]. Integration site: (III:-4.25 cM/ nt 3,771,500). Might still contain unc-119(ed3) in background.
CGC5 C. elegans umnTi2 III. Show Description
umnTi2 [eft-3p::GFP::H2B + unc-119(+)]. Integration site: (III:+13.25 cM/nt 11,816,400). Might still contain unc-119(ed3) in background.
CGC6 C. elegans umnTi3 I. Show Description
umnTi3 [eft-3p::GFP::H2B + unc-119(+)]. Integration site: (I:+30 cM/nt 15,065,881). Might still contain unc-119(ed3) in background.
CGC7 C. elegans umnTi4 I. Show Description
umnTi4 [eft-3p::GFP::H2B + unc-119(+)]. Integration site: (I:+1.58 cM/nt 6,966,807). Might still contain unc-119(ed3) in background.
CGC8 C. elegans umnTi5 IV. Show Description
umnTi5 [eft-3p::GFP::H2B + unc-119(+)]. Integration site: (IV:+8.48 cM/nt 13,215,045). Might still contain unc-119(ed3) in background.
CGC9 C. elegans umnTi6 III. Show Description
umnTi6 [eft-3p::GFP::H2B + unc-119(+)]. Integration site: (III:-1.43 cM/nt 5,935,821). Might still contain unc-119(ed3) in background.
CL2179 C. elegans smg-1(cc546) I; dvIs179. Show Description
dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2337 C. elegans smg-1(cc546) I; dvIs38. Show Description
dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2355 C. elegans smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2621 C. elegans smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2659 C. elegans smg-1(cc546) I; dvIs770. Show Description
dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL4176 C. elegans smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::Abeta(1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL6180 C. elegans smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [gst-4p::GFP::NLS] III. dvIs27 [myo-3p::Abeta(1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL802 C. elegans smg-1(cc546) I; rol-6(su1006) II. Show Description
Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CLP1360 C. elegans pmp-4(twn16) IV. Show Description
twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.
CLP1445 C. elegans pmp-4(twn16) IV; twnEx656. Show Description
twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.
CP161 C. briggsae Cbr-unc-119(nm67) III; nmIs7. Show Description
nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
CP198 C. briggsae Cbr-msrp-3(nm77[HA::Cbr-msrp-3]) I. Show Description
nm77 is an HA epitope tag inserted into the endogenous Cbr-msrp-3 locus, two codons after the predicted signal peptide cleavage site of Cbr-MSRP-3. Anti-HA antibodies recognize the tagged Cbr-MSRP-3 glycoprotein on immunoblots, in the membranous organelles of spermatids, and on the plasma membrane of activated sperm (including pseudopod) in both males and hermaphrodites. To confirm presence of the nm77 insertion, use primers AT19+AT20 (WT: 291 nt, nm77: 318 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
CSG10 C. elegans gsgIs1 IV. Show Description
gsgIs1 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (IV: 5014948). Superficially wild-type. gsgIs1 can be used to generate single-copy insertions in C. elegans Chromosome IV. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG18 C. elegans gsgIs2 I. Show Description
gsgIs2 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (I: 2850968). Superficially wild-type. sgIs2 can be used to generate single-copy insertions in C. elegans Chromosome I. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG36 C. elegans gsgIs5 III. Show Description
gsgIs5 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (III: 7007779). Superficially wild-type. gsgIs5 can be used to generate single-copy insertions in C. elegans Chromosome III. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG53 C. elegans gsgIs8 X. Show Description
gsgIs8 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bpHA2 right] (X: 798667). Superficially wild-type. gsgIs8 can be used to generate single-copy insertions in C. elegans Chromosome X. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG60 C. elegans gsgIs3 II. Show Description
gsgIs3 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (II: 9834540). Superficially wild-type. gsgIs3 can be used to generate single-copy insertions in C. elegans Chromosome II. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG76 C. elegans gsgIs4 V. Show Description
gsgIs4 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (V: 8644845). Superficially wild-type. gsgIs4 can be used to generate single-copy insertions in C. elegans Chromosome V. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CX2065 C. elegans odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
CYA1 C. elegans rexIs1. Show Description
rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CYA13 C. elegans frSi17 II; rde-1(ne300) V; ldrIs1. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.
CYA2 C. elegans rexIs2. Show Description
rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
CZ27593 C. elegans bli-1(ju1789[bli-1::mNG::3xFLAG]) II. Show Description
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
DA2100 C. elegans ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
DA2211 Escherichia coli E. coli. Show Description
Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1.
DDP1 C. elegans uonEx1. Show Description
uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. Pick fluorescent animals to maintain. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.