Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

antIs30 [attP-f + Cbr-unc-119(+) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. antIs30 was inserted into ttTi5605 on LG II using MosSCI. GFP expression in pharynx is very weak (as it is single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.

Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)

umnTi7 [eft-3p::GFP + unc-119(+)] IV. Integration site: (IV:+14.35 cM/nt 15,997,713). Might still contain unc-119(ed3) in background.

umnTi1 [eft-3p::GFP + unc-119(+)]. Integration site: (III:-4.25 cM/ nt 3,771,500). Might still contain unc-119(ed3) in background.

umnTi2 [eft-3p::GFP + unc-119(+)]. Integration site: (III:+13.25 cM/nt 11,816,400). Might still contain unc-119(ed3) in background.

umnTi3 [eft-3p::GFP + unc-119(+)]. Integration site: (I:+30 cM/nt 15,065,881). Might still contain unc-119(ed3) in background.

umnTi4 [eft-3p::GFP + unc-119(+)]. Integration site: (I:+1.58 cM/nt 6,966,807). Might still contain unc-119(ed3) in background.

umnTi5 [eft-3p::GFP + unc-119(+)]. Integration site: (IV:+8.48 cM/nt 13,215,045). Might still contain unc-119(ed3) in background.

umnTi6 [eft-3p::GFP + unc-119(+)]. Integration site: (III:-1.43 cM/nt 5,935,821). Might still contain unc-119(ed3) in background.

dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.

Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]

rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.

rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.

Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.

Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1.

uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.

dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]

dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.

tnIs6 [lim-7::GFP + rol-6(su1006)]. Rollers. lim-7::GFP is expressed in sheath cells (see Hall et al., 1999, Developmental Biology 212: 101-123. Insertion site not mapped.

tnIs5 [lim-7::GFP + rol-6(su1006)]. Rollers. lim-7::GFP is expressed in sheath cells (see Hall et al., 1999, Developmental Biology 212: 101-123. Insertion site not mapped.

tnEx212 [pod-2(+) + sur-5::GFP]. Pick GFP+ animals to maintain. sur-5::gfp(+) animals are wild type and segregate GFP(+) wild-type animals and GFP(-) pod-2(tn1691) dead embryos. tn1691 deletes ~15 kb within pod-2, including most of Exon 2 through to and including the stop codon (but not the polyA site). Reference: Starich TA, et al. eLife 2020;9:e58619 DOI: 10.7554/eLife.58619 PMID: 32735213

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.

bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. Ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi327 [loxN::ckb-3p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Uterine-specific expression of FLPase in Z1/Z4 and their descendants with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Pan-neuronal expression of FLPase with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi350 [loxN::wrt-2p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Hypodermal (seam cell) expression of FLPase with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi362 [loxN::rpl-28p::FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in neurons. High levels of TIR1(F79G) expression in neurons by rgef-1p::FLP with co-expression of membrane markers. bmdSi362 contains the ubiquitous rpl-28 promoter driving expression of FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2 construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315