bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.

qSi246 [glp-1::sfGFP + Cbr-unc-119(+)] IV. Mos insertion of sfGFP tagged GLP-1 in glp-1(0) background. qSi246 rescues glp-1(q46) sterile phenotype. Animals are fertile, superficially wild-type with GFP+ distal germ-lines. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. Anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type.

qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type.

otIs630 [srg-13::BirA::nrx-1 + inx-18p::AP::nlg-1 + unc-122::streptavidin::2xsfGFP + inx-18p::wCherry + rol-6(su1006)] X. Rollers. Trans-synaptic labeling of PHA to AVG synapses (iBLINC). AVG process is labeled with mCherry. Reference: Oren-Suissa M, et al. Nature. 2016; 533:206-211. PMID: 27144354

bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

8xMS2 tag inserted at C-terminus of endogenous C42D4.3 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.

8xMS2 tag inserted at C-terminus of endogenous mai-1 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.

zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.

Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.

qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628