Search Strains

crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024).

Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

bmdSi86 [LoxN::rps-27p::DHB::GFP::P2A::H2B::mKate2] I. bmdSi86 is a single-copy CRISPR/Cas9-engineered insertion of a codon-optimized CDK sensor (amino acids 994–1087 of human DNA Helicase B (DHB) fused to GFP) co-expressed with his-58 (H2B) fused to two copies of mKate2. Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888

bmdSi147 [loxN::rps-27p::DHB::2xmKate2::P2A::H2B::GFP] I. bmdSi147 is a single-copy CRISPR/Cas9-engineered insertion of a codon-optimized CDK sensor (amino acids 994–1087 of human DNA Helicase B (DHB) fused to two copies of mKate2) co-expressed with his-58 (H2B) fused to GFP. Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888

bmdSi200 [loxN::pcn-1p::pcn-1::GFP] I. bmdSi168 [loxN::rps-27p::DHB::2x-mKate2] II. bmdSi200 is a single copy CRISPR/Cas9-engineered insertion of a full length pcn-1::GFP translational fusion under its own promoter. bmdSi168 is a single-copy CRISPR/Cas9-engineered insertion of a codon optimized CDK sensor (amino acids 994–1087 of human DNA Helicase B (DHB) fused to two copies of mKate2). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888

arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.

arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.

arTi137 [ceh-36p::ERK-KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. arTi137 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK-KTR::mClover) that reports MPK-1 kinase activity in AWC and ASE sensory neurons and a co-expressed nuclear histone marker mCherry::H2B). Reference: de la Cova C, et al. Dev Cell. 2017 Sep 11;42(5):542-553.e4. doi: 10.1016/j.devcel.2017.07.014. PMID: 28826819.

arTi355 [rps-27p::GFP(flexon)::Tcut::mScarlet::H2B] IV. arTi237 [ckb-3p::Cre(opti)] X:11.72. Strain for SALSA analysis; pair with control strain GS9322. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.

arTi355 [rps-27p::GFP(flexon)::Tcut::mScarlet::H2B] IV. arTi237 [ckb-3p::Cre(opti)] X:11.72. Reporter-only control for SALSA biosensor; pair with GS9314. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.

arTi362 [rps-27p::TIR1(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (-19.98). The first intron of TIR1 was replaced with a Flexon containing two lox2272 sites. TIR1 is expressed at a high level in lineages where Cre is expressed. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.

arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I (-4.81). First intron of GFP is replaced with a Flexon containing two loxP sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::TIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

ccpSi49 [rps-27p::TIR1[F79G]::3xflag::operon::linker::mCherry::linker::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Ubiquitous expression of TIR1[F79G] for auxin-inducible degradation via addition of 5-Ph-IAA-AM to the media during embryogenesis. The rps-27 promoter expresses broadly across most tissue types, including intestine, body wall muscle, hypodermis, pharynx. It does not express in most neuroblast lineages. Expression levels peak late in embryonic development. TIR1 is expressed in an operon with mCherry-tagged H2B as a single copy insertion on Chr II allowing users to monitor the timing and location of expression. Unknown if unc-119(ed3) is still present in the background

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.