Strain Information
Name | PHX3691 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | sqt-3(syb3691[sqt-3::mNG(int)]) V. |
Description | mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | SUNY Biotech |
Laboratory | UP |
Reference | Birnbaum SK, Cohen JD, Belfi A, Murray JI, Adams JRG, Chisholm AD, Sundaram MV. The proprotein convertase BLI-4 promotes collagen secretion prior to assembly of the Caenorhabditis elegans cuticle. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936; PMCID: PMC10538796. |
Sign in
or
register an account if you want to order this strain.