Search Strains

ulbEx112 [gmap-1p::gmap-1(cDNA)::SL2::GFP + unc-122p::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. ulb13 is a CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Expression of exogenous gmap-1 quantifiable via the GFP signal. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

nsEx1086 [T02B11.3p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.

jpnIs20 [itr-1p::GFP1-10 + odr-1p::DsRed] I. 7xGFP tag was inserted into the N-terminal of the endogenous rab-3 locus. Expression in DA9 synapses can be observed. Generated in N2 background.

Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.

zyIs1 [lin-11::RFP + rol-6(su1006)]. Roller. Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Maintain at 20C or lower. Heterozygotes are wild-type GFP+ and segregate non-GFP unc-60(gk239) fau-1(cc2530) homozygotes (larval arrest), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Note: unc-60(gk239) fau-1(cc2530)/nT1 [qIs51] heterozygotes are are developmentally delayed. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. cc2530 is a nonsense mutation converting the leucine codon at position 5 to a premature stop codon. fau-1 also known as rps-30. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-33(cc2558) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (R9*). Presumptive rpl-33 null. Heterozygous rpl-33(cc2558)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

Heterozygotes are wild-type and should segregate wild-type (ccDf2620/unc-54(e1152) heterozygotes), Unc (unc-54(e1152) homozygotes), and ccDf2620 homozygotes (larval arrest around L1 stage). Maintain by picking heterozygotes and checking for proper segregation of progeny. ccDf2620 removes the rDNA repeats at the end of chromosome I. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

arIs39 [myo-3p::ssGFP + dpy-20(+)].

Dpy. Deletion of entire ceh-24 gene except first five amino acids.

mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. See WBG 15 #5 page 20.

mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.

Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-5(cc5998) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (A166*). Presumptive rpl-5 null. Heterozygous rpl-5(cc5998)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.

Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.

nIs106 [lin-11::GFP + lin-15(+)] X. Homozygous maternal effect lethal ced-9 mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ced-9 homozygotes (maternal effect lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(bn129) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(bn129) homozygotes are short-lived on OP50. bn129 is a deletion removing 748 bp from exon 11 of SET-2L and from exon 3 of SET-2S resulting in a frameshift after 885 aa of SET-2L and after 117 aa of SET-2S with a premature stop four codons later. References: Robert VJ, et al. Front Cell Dev Biol. Dec 2020 Sep 22:8:561791. doi: 10.3389/fcell.2020.561791. PMID: 33072747. Xiao Y, et al. Proc Natl Acad Sci USA. 2011 May 17;108(20):8305-10. doi: 10.1073/pnas.1019290108. PMID: 21527717.

egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

egl-23 cDNA(L229N) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

GFP tag inserted at the C-terminus of the endogenous nlp-58 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

syb3311 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous casy-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Split-GFP tag inserted into endogenous casy-1 locus using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.

Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

Endogenous eat-4 locus tagged with T2A::GFP::H2B. Healthy strain that has all glutamatergic neurons marked with GFP. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.

GFP tag inserted at the C-terminus of the endogenous npr-32 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.

GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

wrmScarlet tag inserted at C-terminus of endogenous stns-1 locus. Lysosomal marker. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447

SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.