Strain Information
| Name | PHX530 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | nlp-11(syb530) II. |
| Description | Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences:tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccatacca acgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447 |
| Mutagen | |
| Outcrossed | x0 |
| Made by | SunyBiotech |
| Laboratory | HBR |
| Reference | Konietzka et al. (2019), Epidermal Growth Factor signaling promotes sleep through a combined series and parallel neural circuit, Current Biology (accepted, but not published yet. DOI will be sent after publication process is finished) |
Sign in
or
register an account if you want to order this strain.