Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.

Wild type. previously called unc-110.

Homozygous viable. Deletion of 3495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATTCTGGGCGAATTTATGATTGCCAATA; Right flanking sequence: GAAGTTGTCCGTGTTGAGCATTTCAATCAC. See WormBase Variation gk5009 for details.

Heterozygotes are Unc and segregate Unc, dead eggs, and Lon males. e1913 is a dominant Unc and recessive lethal. Maintain by picking Unc. e1913 previously called unc-110.

Pick DpyUnc worms to maintain, as e1913 is a dominant Unc and a recessive lethal. Actually, the Uncs are not very Dpy, so pick non-Dpy-looking animals that don't move well. e1913 previously called unc-110.

wtfIs491 [inx-1p::twk-18(gf)::mCherry + unc-122p::RFP]. AIB(-) activated potassium channel. Expression of twk-18 gain-of-function mutant in AIB neurons causes permanent inhibition. RFP expression in coelomocytes. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.

twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.