RB1388 |
C. elegans |
ZK1251.1&ins-7(ok1573) IV. Show Description
ZK1251.1, ZK1251.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
CF2266 |
C. elegans |
muEx340. Show Description
muEx340 [ges-1p::RFP + ges-1p::ins-7]. Intestinal expression of ins-7 shortens lifespan. Pick RFP animals to maintain.
|
|
OH18835 |
C. elegans |
ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
PHX5424 |
C. elegans |
ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
HT1702 |
C. elegans |
unc-119(ed3) III; wwEx66. Show Description
wwEx66 [ins-7p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
|
|