| CB3497 |
C. elegans |
dpy-25(e817) II. Show Description
Dpy. Severe. Semidominant. Inviable at 15C.
|
|
| CB5009 |
C. elegans |
let-552(e2542)/dpy-25(e817) II. Show Description
At 20C or 25C heterozygotes are semi-Dpy and segregate semi-Dpys (heterozygotes), Dpys (dpy-25/dpy-25) and animals which arrest as Dpyish young larvae (let-552/let-552). Maintain by picking semi-Dpy. At 15C it is difficult to distinguish between let-552 homozygotes and dpy-25 homozygotes (e817 is inviable at 15C).
|
|
| CB6452 |
C. elegans |
dpy-25(e817) II; xol-1(y9) X. Show Description
Severe dumpy; dominant, hence crossing with wild-type males yields dumpy hermaphrodites and dead eggs (dpy-25/+; xol-1/0).
|
|
| PD8601 |
C. elegans |
ccDf1/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8602 |
C. elegans |
ccDf2/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8603 |
C. elegans |
ccDf3/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8604 |
C. elegans |
ccDf4/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8605 |
C. elegans |
ccDf5/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8607 |
C. elegans |
ccDf7/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. Rec'd new stock 8/2000.
|
|
| PD8611 |
C. elegans |
ccDf11/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| RG3317 |
C. elegans |
F44E5.5(ve817[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2259 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGAAAAAGAAAGAGGGAGACAGAGTG ; Right flanking sequence: AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA #1: TCTAGAAGATGTTACGGGAA; sgRNA #2: AACAGGCATACATTAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|