Unc-slow moving. Body muscle abnormal. Semi-dominant. Birefringent patches. Eggs laid. M-MATING-NO SUCCESS.

Semi-paralyzed Unc. Stiff.

Moves slowly. Recessive. Lays eggs.

A 600 bp deletion in the unc-60b coding region. unc-60a is intact. Strong Unc - nearly paralyzed. No UNC-60b protein is detected by western blot. UNC-60a is expressed at normal level.

Unc-paralysed. Both Unc-60 and Unc-36. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::mCherry. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Dpy. Unc-slow moving.

Unc. Temperature sensitive-maintain at 15C.

Hermaphrodite ovaries are abnormal in morphology and accumulate many mature but unfertilized oocytes.

Unc strain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

C38C3.5. Homozygous lethal deletion balanced by GFP-marked balancer. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk239 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Dpy. Unc. Temperature sensitive-maintain at 15C.

Dpy. Unc.

Unc. Dpy. Rol(ts).

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

WT strain which segregates WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT.

WT strain that segregates WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.

mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.

mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.

ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.