qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain.

qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygous animals show roller phenotype and GFP signal at the distal tip cells. Segregates roller GFP(+) heterozygotes, wild-type moving GFP(-) him-18(tm2181) homozygotes. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygous animals are dead. P0 him-18(tm2181) homozygous animals show 80% embryonic lethality and 12% high incidence of male at F1. Pick roller GFP(+) worms to maintain. Reference: Saito TT, et al. (2009) PLoS Genet 5:e1000735.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. qa6200 has maternal effect sterility and maternal effect embryonic lethality.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. tm1227 has maternal effect sterility and maternal effect embryonic lethality.

qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.